Order Now: brent@sdlifesciences.com
 WIPI1 Polyclonal Antibody |
|
ES8479-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
WIPI1 Polyclonal Antibody |
|
ABP57486-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide of WIPI1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1 |
WIPI1 Polyclonal Antibody |
|
ABP57486-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide of WIPI1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1 |
WIPI1 Polyclonal Antibody |
|
ABP57486-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide of WIPI1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1 |
WIPI1 Polyclonal Antibody |
|
30955-100ul |
SAB |
100ul |
EUR 252 |
WIPI1 Polyclonal Antibody |
|
30955-50ul |
SAB |
50ul |
EUR 187 |
 WIPI1 Rabbit pAb |
|
A7528-100ul |
Abclonal |
100 ul |
EUR 308 |
WIPI1 Rabbit pAb |
|
A7528-200ul |
Abclonal |
200 ul |
EUR 459 |
WIPI1 Rabbit pAb |
|
A7528-20ul |
Abclonal |
20 ul |
EUR 183 |
WIPI1 Rabbit pAb |
|
A7528-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal WIPI1 Antibody (Center) |
|
APR10749G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications: |
 WIPI1 Polyclonal Conjugated Antibody |
|
C30955 |
SAB |
100ul |
EUR 397 |
 WIPI1 antibody |
|
70R-4358 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1 |
WIPI1 antibody |
|
70R-4359 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1 |
 WIPI1 Antibody |
|
1-CSB-PA705810ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against WIPI1. Recognizes WIPI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
) Polyclonal WIPI1 Antibody (N-term) |
|
APR10751G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications: |
) Polyclonal ATG18 / WIPI1 Antibody (C-Terminus) |
|
APG02035G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
 anti- WIPI1 antibody |
|
FNab09512 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: WD repeat domain, phosphoinositide interacting 1
- Uniprot ID: Q5MNZ9
- Gene ID: 55062
- Research Area: Metabolism
|
|
Description: Antibody raised against WIPI1 |
 Anti-WIPI1 antibody |
|
STJ98592 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to WIPI1. |
Anti-WIPI1 antibody |
|
STJ29666 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants. |
 WIPI1 siRNA |
|
20-abx939857 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WIPI1 siRNA |
|
20-abx939858 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 WIPI1 Blocking Peptide |
|
33R-5144 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359 |
WIPI1 Blocking Peptide |
|
33R-1237 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812 |
 WIPI1 cloning plasmid |
|
CSB-CL705810HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1341
- Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg
- Show more
|
|
Description: A cloning plasmid for the WIPI1 gene. |
) Anti-WIPI1 (3C1) |
|
YF-MA18725 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to WIPI1 |
 Mouse WIPI1 shRNA Plasmid |
|
20-abx974266 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human WIPI1 shRNA Plasmid |
|
20-abx960437 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) WIPI1 Recombinant Protein (Human) |
|
RP034801 |
ABM |
100 ug |
Ask for price |
) WIPI1 Recombinant Protein (Rat) |
|
RP237437 |
ABM |
100 ug |
Ask for price |
) WIPI1 Recombinant Protein (Mouse) |
|
RP185606 |
ABM |
100 ug |
Ask for price |
 (M02), Clone: 3C1) Monoclonal WIPI1 Antibody (monoclonal) (M02), Clone: 3C1 |
|
APR10750G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human WIPI1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C1. This antibody is applicable in WB, E |
 (pORF)) Wipi1 ORF Vector (Rat) (pORF) |
|
ORF079147 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) WIPI1 ORF Vector (Human) (pORF) |
|
ORF011601 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Wipi1 ORF Vector (Mouse) (pORF) |
|
ORF061870 |
ABM |
1.0 ug DNA |
EUR 506 |
) WIPI1 sgRNA CRISPR Lentivector set (Human) |
|
K2640401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Wipi1 sgRNA CRISPR Lentivector set (Rat) |
|
K6158301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Wipi1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3959601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
20-abx142308 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
20-abx007014 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
abx031393-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
abx031393-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
abx029605-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
abx029605-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
20-abx322293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
|
abx239512-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
 (Target 1)) WIPI1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2640402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) WIPI1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2640403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) WIPI1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2640404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6158302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6158303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6158304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3959602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3959603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3959604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) WIPI1 Protein Vector (Human) (pPB-C-His) |
|
PV046401 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) WIPI1 Protein Vector (Human) (pPB-N-His) |
|
PV046402 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) WIPI1 Protein Vector (Human) (pPM-C-HA) |
|
PV046403 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) WIPI1 Protein Vector (Human) (pPM-C-His) |
|
PV046404 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) WIPI1 Protein Vector (Rat) (pPB-C-His) |
|
PV316586 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) WIPI1 Protein Vector (Rat) (pPB-N-His) |
|
PV316587 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) WIPI1 Protein Vector (Rat) (pPM-C-HA) |
|
PV316588 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) WIPI1 Protein Vector (Rat) (pPM-C-His) |
|
PV316589 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) WIPI1 Protein Vector (Mouse) (pPB-C-His) |
|
PV247478 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) WIPI1 Protein Vector (Mouse) (pPB-N-His) |
|
PV247479 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) WIPI1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV247480 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) WIPI1 Protein Vector (Mouse) (pPM-C-His) |
|
PV247481 |
ABM |
500 ng |
EUR 603 |
 Wipi1 3'UTR GFP Stable Cell Line |
|
TU172310 |
ABM |
1.0 ml |
Ask for price |
 WIPI1 3'UTR GFP Stable Cell Line |
|
TU078498 |
ABM |
1.0 ml |
EUR 1394 |
 Wipi1 3'UTR Luciferase Stable Cell Line |
|
TU122310 |
ABM |
1.0 ml |
Ask for price |
 WIPI1 3'UTR Luciferase Stable Cell Line |
|
TU028498 |
ABM |
1.0 ml |
EUR 1394 |
Wipi1 3'UTR Luciferase Stable Cell Line |
|
TU223410 |
ABM |
1.0 ml |
Ask for price |
Wipi1 3'UTR GFP Stable Cell Line |
|
TU273410 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
