WIPI1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

WIPI1 Polyclonal Antibody

ES8479-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

WIPI1 Polyclonal Antibody

ABP57486-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody

ABP57486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody

ABP57486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody

30955-100ul 100ul
EUR 252

WIPI1 Polyclonal Antibody

30955-50ul 50ul
EUR 187

WIPI1 Rabbit pAb

A7528-100ul 100 ul
EUR 308

WIPI1 Rabbit pAb

A7528-200ul 200 ul
EUR 459

WIPI1 Rabbit pAb

A7528-20ul 20 ul
EUR 183

WIPI1 Rabbit pAb

A7528-50ul 50 ul
EUR 223

Polyclonal WIPI1 Antibody (Center)

APR10749G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications:

WIPI1 Polyclonal Conjugated Antibody

C30955 100ul
EUR 397

WIPI1 antibody

70R-4358 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1

WIPI1 antibody

70R-4359 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1

WIPI1 Antibody

1-CSB-PA705810ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against WIPI1. Recognizes WIPI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Polyclonal WIPI1 Antibody (N-term)

APR10751G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal ATG18 / WIPI1 Antibody (C-Terminus)

APG02035G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications:

anti- WIPI1 antibody

FNab09512 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: WD repeat domain, phosphoinositide interacting 1
  • Uniprot ID: Q5MNZ9
  • Gene ID: 55062
  • Research Area: Metabolism
Description: Antibody raised against WIPI1

Anti-WIPI1 antibody

PAab09512 100 ug
EUR 412

Anti-WIPI1 antibody

STJ98592 200 µl
EUR 197
Description: Rabbit polyclonal to WIPI1.

Anti-WIPI1 antibody

STJ29666 100 µl
EUR 277
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants.

WIPI1 siRNA

20-abx939857
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WIPI1 siRNA

20-abx939858
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WIPI1 Blocking Peptide

33R-5144 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359

WIPI1 Blocking Peptide

33R-1237 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812

WIPI1 cloning plasmid

CSB-CL705810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg
  • Show more
Description: A cloning plasmid for the WIPI1 gene.

Anti-WIPI1 (3C1)

YF-MA18725 100 ug
EUR 363
Description: Mouse monoclonal to WIPI1

Mouse WIPI1 shRNA Plasmid

20-abx974266
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WIPI1 ELISA KIT

ELI-17850h 96 Tests
EUR 824

Mouse Wipi1 ELISA KIT

ELI-17524m 96 Tests
EUR 865

WIPI1 ELISA KIT|Human

EF004296 96 Tests
EUR 689

Human WIPI1 shRNA Plasmid

20-abx960437
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WIPI1 Recombinant Protein (Human)

RP034801 100 ug Ask for price

WIPI1 Recombinant Protein (Rat)

RP237437 100 ug Ask for price

WIPI1 Recombinant Protein (Mouse)

RP185606 100 ug Ask for price

pCMV-SPORT6-WIPI1 Plasmid

PVT16839 2 ug
EUR 325

Monoclonal WIPI1 Antibody (monoclonal) (M02), Clone: 3C1

APR10750G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human WIPI1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C1. This antibody is applicable in WB, E

Wipi1 ORF Vector (Rat) (pORF)

ORF079147 1.0 ug DNA
EUR 506

WIPI1 ORF Vector (Human) (pORF)

ORF011601 1.0 ug DNA
EUR 95

Wipi1 ORF Vector (Mouse) (pORF)

ORF061870 1.0 ug DNA
EUR 506

WIPI1 sgRNA CRISPR Lentivector set (Human)

K2640401 3 x 1.0 ug
EUR 339

Wipi1 sgRNA CRISPR Lentivector set (Rat)

K6158301 3 x 1.0 ug
EUR 339

Wipi1 sgRNA CRISPR Lentivector set (Mouse)

K3959601 3 x 1.0 ug
EUR 339

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

20-abx142308
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

20-abx007014
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

abx031393-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

abx031393-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

abx029605-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

abx029605-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

20-abx322293
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody

abx239512-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

WIPI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2640402 1.0 ug DNA
EUR 154

WIPI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2640403 1.0 ug DNA
EUR 154

WIPI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2640404 1.0 ug DNA
EUR 154

Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6158302 1.0 ug DNA
EUR 154

Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6158303 1.0 ug DNA
EUR 154

Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6158304 1.0 ug DNA
EUR 154

Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3959602 1.0 ug DNA
EUR 154

Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3959603 1.0 ug DNA
EUR 154

Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3959604 1.0 ug DNA
EUR 154

WIPI1 Protein Vector (Human) (pPB-C-His)

PV046401 500 ng
EUR 329

WIPI1 Protein Vector (Human) (pPB-N-His)

PV046402 500 ng
EUR 329

WIPI1 Protein Vector (Human) (pPM-C-HA)

PV046403 500 ng
EUR 329

WIPI1 Protein Vector (Human) (pPM-C-His)

PV046404 500 ng
EUR 329

WIPI1 Protein Vector (Rat) (pPB-C-His)

PV316586 500 ng
EUR 603

WIPI1 Protein Vector (Rat) (pPB-N-His)

PV316587 500 ng
EUR 603

WIPI1 Protein Vector (Rat) (pPM-C-HA)

PV316588 500 ng
EUR 603

WIPI1 Protein Vector (Rat) (pPM-C-His)

PV316589 500 ng
EUR 603

WIPI1 Protein Vector (Mouse) (pPB-C-His)

PV247478 500 ng
EUR 603

WIPI1 Protein Vector (Mouse) (pPB-N-His)

PV247479 500 ng
EUR 603

WIPI1 Protein Vector (Mouse) (pPM-C-HA)

PV247480 500 ng
EUR 603

WIPI1 Protein Vector (Mouse) (pPM-C-His)

PV247481 500 ng
EUR 603

Wipi1 3'UTR GFP Stable Cell Line

TU172310 1.0 ml Ask for price

WIPI1 3'UTR GFP Stable Cell Line

TU078498 1.0 ml
EUR 1394

Wipi1 3'UTR Luciferase Stable Cell Line

TU122310 1.0 ml Ask for price

WIPI1 3'UTR Luciferase Stable Cell Line

TU028498 1.0 ml
EUR 1394

Wipi1 3'UTR Luciferase Stable Cell Line

TU223410 1.0 ml Ask for price

Wipi1 3'UTR GFP Stable Cell Line

TU273410 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC