Order Now: brent@sdlifesciences.com
Polyclonal WIPI1 Antibody |
APR10748G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 . This antibody is tested and proven to work in the following applications: |
WIPI1 Polyclonal Antibody |
ABP57486-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide of WIPI1
- Applications tips:
|
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1 |
WIPI1 Polyclonal Antibody |
ABP57486-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide of WIPI1
- Applications tips:
|
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1 |
WIPI1 Polyclonal Antibody |
ABP57486-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide of WIPI1
- Applications tips:
|
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1 |
WIPI1 Polyclonal Antibody |
ES8479-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
WIPI1 Polyclonal Antibody |
ES8479-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
WIPI1 Rabbit pAb |
A7528-100ul |
Abclonal |
100 ul |
EUR 308 |
WIPI1 Rabbit pAb |
A7528-200ul |
Abclonal |
200 ul |
EUR 459 |
WIPI1 Rabbit pAb |
A7528-20ul |
Abclonal |
20 ul |
EUR 183 |
WIPI1 Rabbit pAb |
A7528-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal WIPI1 Antibody (Center) |
APR10749G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications: |
WIPI1 Polyclonal Conjugated Antibody |
C30955 |
SAB |
100ul |
EUR 397 |
WIPI1 Antibody |
1-CSB-PA705810ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against WIPI1. Recognizes WIPI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
WIPI1 antibody |
70R-4358 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1 |
WIPI1 antibody |
70R-4359 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1 |
Polyclonal WIPI1 Antibody (N-term) |
APR10751G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal ATG18 / WIPI1 Antibody (C-Terminus) |
APG02035G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
anti- WIPI1 antibody |
FNab09512 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: WD repeat domain, phosphoinositide interacting 1
- Uniprot ID: Q5MNZ9
- Gene ID: 55062
- Research Area: Metabolism
|
Description: Antibody raised against WIPI1 |
Anti-WIPI1 antibody |
STJ29666 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants. |
Anti-WIPI1 antibody |
STJ98592 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to WIPI1. |
WIPI1 siRNA |
20-abx939857 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WIPI1 siRNA |
20-abx939858 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WIPI1 Blocking Peptide |
33R-5144 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359 |
WIPI1 Blocking Peptide |
33R-1237 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812 |
WIPI1 cloning plasmid |
CSB-CL705810HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1341
- Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg
- Show more
|
Description: A cloning plasmid for the WIPI1 gene. |
Anti-WIPI1 (3C1) |
YF-MA18725 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to WIPI1 |
Mouse WIPI1 shRNA Plasmid |
20-abx974266 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human WIPI1 shRNA Plasmid |
20-abx960437 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
WIPI1 Recombinant Protein (Rat) |
RP237437 |
ABM |
100 ug |
Ask for price |
WIPI1 Recombinant Protein (Human) |
RP034801 |
ABM |
100 ug |
Ask for price |
WIPI1 Recombinant Protein (Mouse) |
RP185606 |
ABM |
100 ug |
Ask for price |
Monoclonal WIPI1 Antibody (monoclonal) (M02), Clone: 3C1 |
APR10750G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human WIPI1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C1. This antibody is applicable in WB, E |
Wipi1 ORF Vector (Mouse) (pORF) |
ORF061870 |
ABM |
1.0 ug DNA |
EUR 506 |
Wipi1 ORF Vector (Rat) (pORF) |
ORF079147 |
ABM |
1.0 ug DNA |
EUR 506 |
WIPI1 ORF Vector (Human) (pORF) |
ORF011601 |
ABM |
1.0 ug DNA |
EUR 95 |
Wipi1 sgRNA CRISPR Lentivector set (Rat) |
K6158301 |
ABM |
3 x 1.0 ug |
EUR 339 |
WIPI1 sgRNA CRISPR Lentivector set (Human) |
K2640401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Wipi1 sgRNA CRISPR Lentivector set (Mouse) |
K3959601 |
ABM |
3 x 1.0 ug |
EUR 339 |
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
20-abx007014 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
20-abx142308 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
abx031393-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
abx031393-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
abx029605-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
abx029605-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
abx239512-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody |
20-abx322293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6158302 |
ABM |
1.0 ug DNA |
EUR 154 |
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6158303 |
ABM |
1.0 ug DNA |
EUR 154 |
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6158304 |
ABM |
1.0 ug DNA |
EUR 154 |
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2640402 |
ABM |
1.0 ug DNA |
EUR 154 |
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2640403 |
ABM |
1.0 ug DNA |
EUR 154 |
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2640404 |
ABM |
1.0 ug DNA |
EUR 154 |
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3959602 |
ABM |
1.0 ug DNA |
EUR 154 |
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3959603 |
ABM |
1.0 ug DNA |
EUR 154 |
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3959604 |
ABM |
1.0 ug DNA |
EUR 154 |
WIPI1 Protein Vector (Mouse) (pPB-C-His) |
PV247478 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Mouse) (pPB-N-His) |
PV247479 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Mouse) (pPM-C-HA) |
PV247480 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Mouse) (pPM-C-His) |
PV247481 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Rat) (pPB-C-His) |
PV316586 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Rat) (pPB-N-His) |
PV316587 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Rat) (pPM-C-HA) |
PV316588 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Rat) (pPM-C-His) |
PV316589 |
ABM |
500 ng |
EUR 603 |
WIPI1 Protein Vector (Human) (pPB-C-His) |
PV046401 |
ABM |
500 ng |
EUR 329 |
WIPI1 Protein Vector (Human) (pPB-N-His) |
PV046402 |
ABM |
500 ng |
EUR 329 |
WIPI1 Protein Vector (Human) (pPM-C-HA) |
PV046403 |
ABM |
500 ng |
EUR 329 |
WIPI1 Protein Vector (Human) (pPM-C-His) |
PV046404 |
ABM |
500 ng |
EUR 329 |
Wipi1 3'UTR Luciferase Stable Cell Line |
TU122310 |
ABM |
1.0 ml |
Ask for price |
WIPI1 3'UTR GFP Stable Cell Line |
TU078498 |
ABM |
1.0 ml |
EUR 1394 |
Wipi1 3'UTR GFP Stable Cell Line |
TU172310 |
ABM |
1.0 ml |
Ask for price |
Wipi1 3'UTR Luciferase Stable Cell Line |
TU223410 |
ABM |
1.0 ml |
Ask for price |
WIPI1 3'UTR Luciferase Stable Cell Line |
TU028498 |
ABM |
1.0 ml |
EUR 1394 |
Wipi1 3'UTR GFP Stable Cell Line |
TU273410 |
ABM |
1.0 ml |
Ask for price |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |