VPS35 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

VPS35 Rabbit pAb
A7117-100ul	Abclonal	100 ul	EUR 308

VPS35 Rabbit pAb
A7117-200ul	Abclonal	200 ul	EUR 459

VPS35 Rabbit pAb
A7117-20ul	Abclonal	20 ul	EUR 183

VPS35 Rabbit pAb
A7117-50ul	Abclonal	50 ul	EUR 223

Polyclonal VPS35 Antibody (C-Terminus)
AMM08483G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPS35 (C-Terminus). This antibody is tested and proven to work in the following applications:

VPS35 Antibody
49784-100ul	SAB	100ul	EUR 333

VPS35 Antibody
49784-50ul	SAB	50ul	EUR 239

VPS35 Antibody
43824-100ul	SAB	100ul	EUR 252

VPS35 Antibody
42841-100ul	SAB	100ul	EUR 252

VPS35 antibody
22838-100ul	SAB	100ul	EUR 390

VPS35 antibody
70R-13144	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal VPS35 antibody

VPS35 Antibody
DF12793	Affbiotech	200ul	EUR 304
Description: VPS35 Antibody detects endogenous levels of VPS35.

VPS35 Antibody
1-CSB-PA839401ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VPS35 Antibody
1-CSB-PA076908	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

VPS35 Antibody
1-CSB-PA088155	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Polyclonal Goat Anti-VPS35 / MEM3 Antibody
APR16425G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VPS35 / MEM3 . This antibody is tested and proven to work in the following applications:

VPS35 Conjugated Antibody
C42841	SAB	100ul	EUR 397

VPS35 Conjugated Antibody
C43824	SAB	100ul	EUR 397

VPS35 Conjugated Antibody
C49784	SAB	100ul	EUR 397

anti- VPS35 antibody
FNab09439	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IP: 1:200-1：2000 IF: 1：10-1：100 Immunogen: vacuolar protein sorting 35 homolog(S. cerevisiae) Uniprot ID: Q96QK1 Gene ID: 55737 Research Area: Neuroscience
Description: Antibody raised against VPS35

Anti-VPS35 antibody
PAab09439	Lifescience Market	100 ug	EUR 386

Anti-VPS35 antibody
STJ98618	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to VPS35.

Anti-VPS35 antibody
STJ29197	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex.

VPS35 siRNA
20-abx939516	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VPS35 siRNA
20-abx939517	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-VPS35
YF-PA26356	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to VPS35

Anti-VPS35 Monoclonal Antibody
M01644	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal VPS35 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-VPS35 / MEM3 antibody
STJ70506	St John's Laboratory	100 µg	EUR 359

Monoclonal antibody for VPS35
SMC-602D	Stressmarq	0.1mg	EUR 403
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-602D-A390	Stressmarq	0.1mg	EUR 450
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35
SMC-602D-A488	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35
SMC-602D-A565	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35
SMC-602D-A594	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35
SMC-602D-A633	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35
SMC-602D-A655	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35
SMC-602D-A680	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35
SMC-602D-A700	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35
SMC-602D-ALP	Stressmarq	0.1mg	EUR 443
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35
SMC-602D-APC	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35
SMC-602D-APCCY7	Stressmarq	0.1mg	EUR 520
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35
SMC-602D-BI	Stressmarq	0.1mg	EUR 445
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35
SMC-602D-DY350	Stressmarq	0.1mg	EUR 463
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35
SMC-602D-DY405	Stressmarq	0.1mg	EUR 452
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35
SMC-602D-DY488	Stressmarq	0.1mg	EUR 442
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35
SMC-602D-DY594	Stressmarq	0.1mg	EUR 444
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35
SMC-602D-DY633	Stressmarq	0.1mg	EUR 439
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35
SMC-602D-FITC	Stressmarq	0.1mg	EUR 441
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35
SMC-602D-HRP	Stressmarq	0.1mg	EUR 437
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35
SMC-602D-P594	Stressmarq	0.1mg	EUR 456
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35
SMC-602D-PCP	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35
SMC-602D-RPE	Stressmarq	0.1mg	EUR 446
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35
SMC-602D-STR	Stressmarq	0.1mg	EUR 447
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35
SMC-602S	Stressmarq	0.012mg	EUR 65
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-603D	Stressmarq	0.1mg	EUR 403
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-603D-A390	Stressmarq	0.1mg	EUR 450
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35
SMC-603D-A488	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35
SMC-603D-A565	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35
SMC-603D-A594	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35
SMC-603D-A633	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35
SMC-603D-A655	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35
SMC-603D-A680	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35
SMC-603D-A700	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35
SMC-603D-ALP	Stressmarq	0.1mg	EUR 443
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35
SMC-603D-APC	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35
SMC-603D-APCCY7	Stressmarq	0.1mg	EUR 520
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35
SMC-603D-BI	Stressmarq	0.1mg	EUR 445
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35
SMC-603D-DY350	Stressmarq	0.1mg	EUR 463
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35
SMC-603D-DY405	Stressmarq	0.1mg	EUR 452
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35
SMC-603D-DY488	Stressmarq	0.1mg	EUR 442
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35
SMC-603D-DY594	Stressmarq	0.1mg	EUR 444
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35
SMC-603D-DY633	Stressmarq	0.1mg	EUR 439
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35
SMC-603D-FITC	Stressmarq	0.1mg	EUR 441
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35
SMC-603D-HRP	Stressmarq	0.1mg	EUR 437
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35
SMC-603D-P594	Stressmarq	0.1mg	EUR 456
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35
SMC-603D-PCP	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35
SMC-603D-RPE	Stressmarq	0.1mg	EUR 446
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35
SMC-603D-STR	Stressmarq	0.1mg	EUR 447
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35
SMC-603S	Stressmarq	0.012mg	EUR 65
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-604D	Stressmarq	0.1mg	EUR 403
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-604D-A390	Stressmarq	0.1mg	EUR 450
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35
SMC-604D-A488	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35
SMC-604D-A565	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35
SMC-604D-A594	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35
SMC-604D-A633	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35
SMC-604D-A655	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35
SMC-604D-A680	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35
SMC-604D-A700	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35
SMC-604D-ALP	Stressmarq	0.1mg	EUR 443
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35
SMC-604D-APC	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35
SMC-604D-APCCY7	Stressmarq	0.1mg	EUR 520
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35
SMC-604D-BI	Stressmarq	0.1mg	EUR 445
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35
SMC-604D-DY350	Stressmarq	0.1mg	EUR 463
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35
SMC-604D-DY405	Stressmarq	0.1mg	EUR 452
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35
SMC-604D-DY488	Stressmarq	0.1mg	EUR 442
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35
SMC-604D-DY594	Stressmarq	0.1mg	EUR 444
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35
SMC-604D-DY633	Stressmarq	0.1mg	EUR 439
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35
SMC-604D-FITC	Stressmarq	0.1mg	EUR 441
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35
SMC-604D-HRP	Stressmarq	0.1mg	EUR 437
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35
SMC-604D-P594	Stressmarq	0.1mg	EUR 456
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35
SMC-604D-PCP	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35
SMC-604D-RPE	Stressmarq	0.1mg	EUR 446
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35
SMC-604D-STR	Stressmarq	0.1mg	EUR 447
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35
SMC-604S	Stressmarq	0.012mg	EUR 65
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-605D	Stressmarq	0.1mg	EUR 403
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-605D-A390	Stressmarq	0.1mg	EUR 450
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35
SMC-605D-A488	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35
SMC-605D-A565	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35
SMC-605D-A594	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35
SMC-605D-A633	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35
SMC-605D-A655	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35
SMC-605D-A680	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35
SMC-605D-A700	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35
SMC-605D-ALP	Stressmarq	0.1mg	EUR 443
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35
SMC-605D-APC	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35
SMC-605D-APCCY7	Stressmarq	0.1mg	EUR 520
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35
SMC-605D-BI	Stressmarq	0.1mg	EUR 445
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35
SMC-605D-DY350	Stressmarq	0.1mg	EUR 463
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35
SMC-605D-DY405	Stressmarq	0.1mg	EUR 452
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35
SMC-605D-DY488	Stressmarq	0.1mg	EUR 442
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35
SMC-605D-DY594	Stressmarq	0.1mg	EUR 444
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35
SMC-605D-DY633	Stressmarq	0.1mg	EUR 439
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35
SMC-605D-FITC	Stressmarq	0.1mg	EUR 441
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35
SMC-605D-HRP	Stressmarq	0.1mg	EUR 437
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35
SMC-605D-P594	Stressmarq	0.1mg	EUR 456
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35
SMC-605D-PCP	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35
SMC-605D-RPE	Stressmarq	0.1mg	EUR 446
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35
SMC-605D-STR	Stressmarq	0.1mg	EUR 447
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35
SMC-605S	Stressmarq	0.012mg	EUR 65
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-606D	Stressmarq	0.1mg	EUR 403
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is not conjugated.

Monoclonal antibody for VPS35
SMC-606D-A390	Stressmarq	0.1mg	EUR 450
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390.

Monoclonal antibody for VPS35
SMC-606D-A488	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488.

Monoclonal antibody for VPS35
SMC-606D-A565	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565.

Monoclonal antibody for VPS35
SMC-606D-A594	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594.

Monoclonal antibody for VPS35
SMC-606D-A633	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633.

Monoclonal antibody for VPS35
SMC-606D-A655	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655.

Monoclonal antibody for VPS35
SMC-606D-A680	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680.

Monoclonal antibody for VPS35
SMC-606D-A700	Stressmarq	0.1mg	EUR 449
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700.

Monoclonal antibody for VPS35
SMC-606D-ALP	Stressmarq	0.1mg	EUR 443
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VPS35
SMC-606D-APC	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with APC.

Monoclonal antibody for VPS35
SMC-606D-APCCY7	Stressmarq	0.1mg	EUR 520
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7.

Monoclonal antibody for VPS35
SMC-606D-BI	Stressmarq	0.1mg	EUR 445
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Biotin.

Monoclonal antibody for VPS35
SMC-606D-DY350	Stressmarq	0.1mg	EUR 463
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350.

Monoclonal antibody for VPS35
SMC-606D-DY405	Stressmarq	0.1mg	EUR 452
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405.

Monoclonal antibody for VPS35
SMC-606D-DY488	Stressmarq	0.1mg	EUR 442
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488.

Monoclonal antibody for VPS35
SMC-606D-DY594	Stressmarq	0.1mg	EUR 444
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594.

Monoclonal antibody for VPS35
SMC-606D-DY633	Stressmarq	0.1mg	EUR 439
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633.

Monoclonal antibody for VPS35
SMC-606D-FITC	Stressmarq	0.1mg	EUR 441
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with FITC.

Monoclonal antibody for VPS35
SMC-606D-HRP	Stressmarq	0.1mg	EUR 437
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with HRP.

Monoclonal antibody for VPS35
SMC-606D-P594	Stressmarq	0.1mg	EUR 456
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594.

Monoclonal antibody for VPS35
SMC-606D-PCP	Stressmarq	0.1mg	EUR 448
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with PerCP.

Monoclonal antibody for VPS35
SMC-606D-RPE	Stressmarq	0.1mg	EUR 446
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with RPE.

Monoclonal antibody for VPS35
SMC-606D-STR	Stressmarq	0.1mg	EUR 447
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin.

Monoclonal antibody for VPS35
SMC-606S	Stressmarq	0.012mg	EUR 65
Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f Show more
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is not conjugated.

VPS35 Blocking Peptide
DF12793-BP	Affbiotech	1mg	EUR 195

VPS35 cloning plasmid
CSB-CL839401HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2391 Sequence: atgcctacaacacagcagtcccctcaggatgagcaggaaaagctcttggatgaagccatacaggctgtgaaggtccagtcattccaaatgaagagatgcctggacaaaaacaagcttatggatgctctaaaacatgcttctaatatgcttggtgaactccggacttctatgttat Show more
Description: A cloning plasmid for the VPS35 gene.

Anti-VPS35 (2D3)
YF-MA11568	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VPS35

Mouse VPS35 shRNA Plasmid
20-abx975334	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.