Order Now: brent@sdlifesciences.com
VPS35 Rabbit pAb |
A7117-100ul |
Abclonal |
100 ul |
EUR 308 |
VPS35 Rabbit pAb |
A7117-200ul |
Abclonal |
200 ul |
EUR 459 |
VPS35 Rabbit pAb |
A7117-20ul |
Abclonal |
20 ul |
EUR 183 |
VPS35 Rabbit pAb |
A7117-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal VPS35 Antibody (C-Terminus) |
AMM08483G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPS35 (C-Terminus). This antibody is tested and proven to work in the following applications: |
VPS35 Antibody |
49784-100ul |
SAB |
100ul |
EUR 333 |
VPS35 Antibody |
49784-50ul |
SAB |
50ul |
EUR 239 |
VPS35 Antibody |
43824-100ul |
SAB |
100ul |
EUR 252 |
VPS35 Antibody |
42841-100ul |
SAB |
100ul |
EUR 252 |
VPS35 antibody |
22838-100ul |
SAB |
100ul |
EUR 390 |
VPS35 antibody |
70R-13144 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal VPS35 antibody |
VPS35 Antibody |
DF12793 |
Affbiotech |
200ul |
EUR 304 |
Description: VPS35 Antibody detects endogenous levels of VPS35. |
VPS35 Antibody |
1-CSB-PA839401ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
VPS35 Antibody |
1-CSB-PA076908 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
VPS35 Antibody |
1-CSB-PA088155 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VPS35. Recognizes VPS35 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
Polyclonal Goat Anti-VPS35 / MEM3 Antibody |
APR16425G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VPS35 / MEM3 . This antibody is tested and proven to work in the following applications: |
VPS35 Conjugated Antibody |
C42841 |
SAB |
100ul |
EUR 397 |
VPS35 Conjugated Antibody |
C43824 |
SAB |
100ul |
EUR 397 |
VPS35 Conjugated Antibody |
C49784 |
SAB |
100ul |
EUR 397 |
anti- VPS35 antibody |
FNab09439 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:2000
- IF: 1:10-1:100
- Immunogen: vacuolar protein sorting 35 homolog(S. cerevisiae)
- Uniprot ID: Q96QK1
- Gene ID: 55737
- Research Area: Neuroscience
|
Description: Antibody raised against VPS35 |
Anti-VPS35 antibody |
STJ98618 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to VPS35. |
Anti-VPS35 antibody |
STJ29197 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. |
VPS35 siRNA |
20-abx939516 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VPS35 siRNA |
20-abx939517 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-VPS35 |
YF-PA26356 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to VPS35 |
Anti-VPS35 Monoclonal Antibody |
M01644 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal VPS35 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Monoclonal antibody for VPS35 |
SMC-602D |
Stressmarq |
0.1mg |
EUR 403 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-602D-A390 |
Stressmarq |
0.1mg |
EUR 450 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390. |
Monoclonal antibody for VPS35 |
SMC-602D-A488 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488. |
Monoclonal antibody for VPS35 |
SMC-602D-A565 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565. |
Monoclonal antibody for VPS35 |
SMC-602D-A594 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-602D-A633 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633. |
Monoclonal antibody for VPS35 |
SMC-602D-A655 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655. |
Monoclonal antibody for VPS35 |
SMC-602D-A680 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680. |
Monoclonal antibody for VPS35 |
SMC-602D-A700 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700. |
Monoclonal antibody for VPS35 |
SMC-602D-ALP |
Stressmarq |
0.1mg |
EUR 443 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for VPS35 |
SMC-602D-APC |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC. |
Monoclonal antibody for VPS35 |
SMC-602D-APCCY7 |
Stressmarq |
0.1mg |
EUR 520 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7. |
Monoclonal antibody for VPS35 |
SMC-602D-BI |
Stressmarq |
0.1mg |
EUR 445 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin. |
Monoclonal antibody for VPS35 |
SMC-602D-DY350 |
Stressmarq |
0.1mg |
EUR 463 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350. |
Monoclonal antibody for VPS35 |
SMC-602D-DY405 |
Stressmarq |
0.1mg |
EUR 452 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405. |
Monoclonal antibody for VPS35 |
SMC-602D-DY488 |
Stressmarq |
0.1mg |
EUR 442 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488. |
Monoclonal antibody for VPS35 |
SMC-602D-DY594 |
Stressmarq |
0.1mg |
EUR 444 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594. |
Monoclonal antibody for VPS35 |
SMC-602D-DY633 |
Stressmarq |
0.1mg |
EUR 439 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633. |
Monoclonal antibody for VPS35 |
SMC-602D-FITC |
Stressmarq |
0.1mg |
EUR 441 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC. |
Monoclonal antibody for VPS35 |
SMC-602D-HRP |
Stressmarq |
0.1mg |
EUR 437 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP. |
Monoclonal antibody for VPS35 |
SMC-602D-P594 |
Stressmarq |
0.1mg |
EUR 456 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-602D-PCP |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP. |
Monoclonal antibody for VPS35 |
SMC-602D-RPE |
Stressmarq |
0.1mg |
EUR 446 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE. |
Monoclonal antibody for VPS35 |
SMC-602D-STR |
Stressmarq |
0.1mg |
EUR 447 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin. |
Monoclonal antibody for VPS35 |
SMC-602S |
Stressmarq |
0.012mg |
EUR 65 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 7E4 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-603D |
Stressmarq |
0.1mg |
EUR 403 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-603D-A390 |
Stressmarq |
0.1mg |
EUR 450 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390. |
Monoclonal antibody for VPS35 |
SMC-603D-A488 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488. |
Monoclonal antibody for VPS35 |
SMC-603D-A565 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565. |
Monoclonal antibody for VPS35 |
SMC-603D-A594 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-603D-A633 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633. |
Monoclonal antibody for VPS35 |
SMC-603D-A655 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655. |
Monoclonal antibody for VPS35 |
SMC-603D-A680 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680. |
Monoclonal antibody for VPS35 |
SMC-603D-A700 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700. |
Monoclonal antibody for VPS35 |
SMC-603D-ALP |
Stressmarq |
0.1mg |
EUR 443 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for VPS35 |
SMC-603D-APC |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC. |
Monoclonal antibody for VPS35 |
SMC-603D-APCCY7 |
Stressmarq |
0.1mg |
EUR 520 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7. |
Monoclonal antibody for VPS35 |
SMC-603D-BI |
Stressmarq |
0.1mg |
EUR 445 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin. |
Monoclonal antibody for VPS35 |
SMC-603D-DY350 |
Stressmarq |
0.1mg |
EUR 463 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350. |
Monoclonal antibody for VPS35 |
SMC-603D-DY405 |
Stressmarq |
0.1mg |
EUR 452 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405. |
Monoclonal antibody for VPS35 |
SMC-603D-DY488 |
Stressmarq |
0.1mg |
EUR 442 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488. |
Monoclonal antibody for VPS35 |
SMC-603D-DY594 |
Stressmarq |
0.1mg |
EUR 444 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594. |
Monoclonal antibody for VPS35 |
SMC-603D-DY633 |
Stressmarq |
0.1mg |
EUR 439 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633. |
Monoclonal antibody for VPS35 |
SMC-603D-FITC |
Stressmarq |
0.1mg |
EUR 441 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC. |
Monoclonal antibody for VPS35 |
SMC-603D-HRP |
Stressmarq |
0.1mg |
EUR 437 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP. |
Monoclonal antibody for VPS35 |
SMC-603D-P594 |
Stressmarq |
0.1mg |
EUR 456 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-603D-PCP |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP. |
Monoclonal antibody for VPS35 |
SMC-603D-RPE |
Stressmarq |
0.1mg |
EUR 446 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE. |
Monoclonal antibody for VPS35 |
SMC-603D-STR |
Stressmarq |
0.1mg |
EUR 447 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin. |
Monoclonal antibody for VPS35 |
SMC-603S |
Stressmarq |
0.012mg |
EUR 65 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 5A9 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-604D |
Stressmarq |
0.1mg |
EUR 403 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-604D-A390 |
Stressmarq |
0.1mg |
EUR 450 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390. |
Monoclonal antibody for VPS35 |
SMC-604D-A488 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488. |
Monoclonal antibody for VPS35 |
SMC-604D-A565 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565. |
Monoclonal antibody for VPS35 |
SMC-604D-A594 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-604D-A633 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633. |
Monoclonal antibody for VPS35 |
SMC-604D-A655 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655. |
Monoclonal antibody for VPS35 |
SMC-604D-A680 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680. |
Monoclonal antibody for VPS35 |
SMC-604D-A700 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700. |
Monoclonal antibody for VPS35 |
SMC-604D-ALP |
Stressmarq |
0.1mg |
EUR 443 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for VPS35 |
SMC-604D-APC |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC. |
Monoclonal antibody for VPS35 |
SMC-604D-APCCY7 |
Stressmarq |
0.1mg |
EUR 520 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7. |
Monoclonal antibody for VPS35 |
SMC-604D-BI |
Stressmarq |
0.1mg |
EUR 445 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin. |
Monoclonal antibody for VPS35 |
SMC-604D-DY350 |
Stressmarq |
0.1mg |
EUR 463 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350. |
Monoclonal antibody for VPS35 |
SMC-604D-DY405 |
Stressmarq |
0.1mg |
EUR 452 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405. |
Monoclonal antibody for VPS35 |
SMC-604D-DY488 |
Stressmarq |
0.1mg |
EUR 442 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488. |
Monoclonal antibody for VPS35 |
SMC-604D-DY594 |
Stressmarq |
0.1mg |
EUR 444 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594. |
Monoclonal antibody for VPS35 |
SMC-604D-DY633 |
Stressmarq |
0.1mg |
EUR 439 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633. |
Monoclonal antibody for VPS35 |
SMC-604D-FITC |
Stressmarq |
0.1mg |
EUR 441 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC. |
Monoclonal antibody for VPS35 |
SMC-604D-HRP |
Stressmarq |
0.1mg |
EUR 437 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP. |
Monoclonal antibody for VPS35 |
SMC-604D-P594 |
Stressmarq |
0.1mg |
EUR 456 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-604D-PCP |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP. |
Monoclonal antibody for VPS35 |
SMC-604D-RPE |
Stressmarq |
0.1mg |
EUR 446 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE. |
Monoclonal antibody for VPS35 |
SMC-604D-STR |
Stressmarq |
0.1mg |
EUR 447 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin. |
Monoclonal antibody for VPS35 |
SMC-604S |
Stressmarq |
0.012mg |
EUR 65 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 8A3 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-605D |
Stressmarq |
0.1mg |
EUR 403 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-605D-A390 |
Stressmarq |
0.1mg |
EUR 450 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390. |
Monoclonal antibody for VPS35 |
SMC-605D-A488 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488. |
Monoclonal antibody for VPS35 |
SMC-605D-A565 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565. |
Monoclonal antibody for VPS35 |
SMC-605D-A594 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-605D-A633 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633. |
Monoclonal antibody for VPS35 |
SMC-605D-A655 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655. |
Monoclonal antibody for VPS35 |
SMC-605D-A680 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680. |
Monoclonal antibody for VPS35 |
SMC-605D-A700 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700. |
Monoclonal antibody for VPS35 |
SMC-605D-ALP |
Stressmarq |
0.1mg |
EUR 443 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for VPS35 |
SMC-605D-APC |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC. |
Monoclonal antibody for VPS35 |
SMC-605D-APCCY7 |
Stressmarq |
0.1mg |
EUR 520 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7. |
Monoclonal antibody for VPS35 |
SMC-605D-BI |
Stressmarq |
0.1mg |
EUR 445 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Biotin. |
Monoclonal antibody for VPS35 |
SMC-605D-DY350 |
Stressmarq |
0.1mg |
EUR 463 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350. |
Monoclonal antibody for VPS35 |
SMC-605D-DY405 |
Stressmarq |
0.1mg |
EUR 452 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405. |
Monoclonal antibody for VPS35 |
SMC-605D-DY488 |
Stressmarq |
0.1mg |
EUR 442 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488. |
Monoclonal antibody for VPS35 |
SMC-605D-DY594 |
Stressmarq |
0.1mg |
EUR 444 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594. |
Monoclonal antibody for VPS35 |
SMC-605D-DY633 |
Stressmarq |
0.1mg |
EUR 439 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633. |
Monoclonal antibody for VPS35 |
SMC-605D-FITC |
Stressmarq |
0.1mg |
EUR 441 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with FITC. |
Monoclonal antibody for VPS35 |
SMC-605D-HRP |
Stressmarq |
0.1mg |
EUR 437 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with HRP. |
Monoclonal antibody for VPS35 |
SMC-605D-P594 |
Stressmarq |
0.1mg |
EUR 456 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-605D-PCP |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with PerCP. |
Monoclonal antibody for VPS35 |
SMC-605D-RPE |
Stressmarq |
0.1mg |
EUR 446 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with RPE. |
Monoclonal antibody for VPS35 |
SMC-605D-STR |
Stressmarq |
0.1mg |
EUR 447 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin. |
Monoclonal antibody for VPS35 |
SMC-605S |
Stressmarq |
0.012mg |
EUR 65 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 10A8 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:200); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-606D |
Stressmarq |
0.1mg |
EUR 403 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is not conjugated. |
Monoclonal antibody for VPS35 |
SMC-606D-A390 |
Stressmarq |
0.1mg |
EUR 450 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 390. |
Monoclonal antibody for VPS35 |
SMC-606D-A488 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 488. |
Monoclonal antibody for VPS35 |
SMC-606D-A565 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 565. |
Monoclonal antibody for VPS35 |
SMC-606D-A594 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-606D-A633 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 633. |
Monoclonal antibody for VPS35 |
SMC-606D-A655 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 655. |
Monoclonal antibody for VPS35 |
SMC-606D-A680 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 680. |
Monoclonal antibody for VPS35 |
SMC-606D-A700 |
Stressmarq |
0.1mg |
EUR 449 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with ATTO 700. |
Monoclonal antibody for VPS35 |
SMC-606D-ALP |
Stressmarq |
0.1mg |
EUR 443 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for VPS35 |
SMC-606D-APC |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with APC. |
Monoclonal antibody for VPS35 |
SMC-606D-APCCY7 |
Stressmarq |
0.1mg |
EUR 520 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with APC/Cy7. |
Monoclonal antibody for VPS35 |
SMC-606D-BI |
Stressmarq |
0.1mg |
EUR 445 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Biotin. |
Monoclonal antibody for VPS35 |
SMC-606D-DY350 |
Stressmarq |
0.1mg |
EUR 463 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 350. |
Monoclonal antibody for VPS35 |
SMC-606D-DY405 |
Stressmarq |
0.1mg |
EUR 452 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 405. |
Monoclonal antibody for VPS35 |
SMC-606D-DY488 |
Stressmarq |
0.1mg |
EUR 442 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 488. |
Monoclonal antibody for VPS35 |
SMC-606D-DY594 |
Stressmarq |
0.1mg |
EUR 444 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 594. |
Monoclonal antibody for VPS35 |
SMC-606D-DY633 |
Stressmarq |
0.1mg |
EUR 439 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Dylight 633. |
Monoclonal antibody for VPS35 |
SMC-606D-FITC |
Stressmarq |
0.1mg |
EUR 441 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with FITC. |
Monoclonal antibody for VPS35 |
SMC-606D-HRP |
Stressmarq |
0.1mg |
EUR 437 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with HRP. |
Monoclonal antibody for VPS35 |
SMC-606D-P594 |
Stressmarq |
0.1mg |
EUR 456 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with PE/ATTO 594. |
Monoclonal antibody for VPS35 |
SMC-606D-PCP |
Stressmarq |
0.1mg |
EUR 448 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with PerCP. |
Monoclonal antibody for VPS35 |
SMC-606D-RPE |
Stressmarq |
0.1mg |
EUR 446 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with RPE. |
Monoclonal antibody for VPS35 |
SMC-606D-STR |
Stressmarq |
0.1mg |
EUR 447 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is conjugated with Streptavidin. |
Monoclonal antibody for VPS35 |
SMC-606S |
Stressmarq |
0.012mg |
EUR 65 |
- Vacuolar Protein Sorter-35 (VPS35) is a component of the retromer complex, which is essential for endosome-to-Golgi retrieval of membrane proteins. VPS35 mutations such as D620N have been linked to Parkinson?s Disease (PD) (1,2) and affect retromer f
- Show more
|
Description: A monoclonal antibody from clone 11H10 against Human VPS35. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Full length recombinant human VSP35. The antibody is tested and validated for WB, IP assays with the following recommended dilutions: WB (1:1000); IP (1:200). This MAb for VPS35 is not conjugated. |
VPS35 Blocking Peptide |
DF12793-BP |
Affbiotech |
1mg |
EUR 195 |
VPS35 cloning plasmid |
CSB-CL839401HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2391
- Sequence: atgcctacaacacagcagtcccctcaggatgagcaggaaaagctcttggatgaagccatacaggctgtgaaggtccagtcattccaaatgaagagatgcctggacaaaaacaagcttatggatgctctaaaacatgcttctaatatgcttggtgaactccggacttctatgttat
- Show more
|
Description: A cloning plasmid for the VPS35 gene. |
Anti-VPS35 (2D3) |
YF-MA11568 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VPS35 |
Mouse VPS35 shRNA Plasmid |
20-abx975334 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|