TRAF4 Rabbit Polyclonal Antibody

Order Now:

TRAF4 Polyclonal Antibody

ES8076-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAF4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRAF4 Rabbit pAb

A7047-100ul 100 ul
EUR 308

TRAF4 Rabbit pAb

A7047-200ul 200 ul
EUR 459

TRAF4 Rabbit pAb

A7047-20ul 20 ul
EUR 183

TRAF4 Rabbit pAb

A7047-50ul 50 ul
EUR 223

Anti-TRAF4 Rabbit Monoclonal Antibody

M03069 100ug/vial
EUR 397
Description: Rabbit Monoclonal TRAF4 Antibody. Validated in IF, WB and tested in Human, Mouse.

TRAF4 antibody

70R-10513 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRAF4 antibody

TRAF4 antibody

70R-20956 50 ul
EUR 435
Description: Rabbit polyclonal TRAF4 antibody

TRAF4 Antibody

47224-100ul 100ul
EUR 252

TRAF4 Antibody

35240-100ul 100ul
EUR 252

TRAF4 Antibody

35240-50ul 50ul
EUR 187

TRAF4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TRAF4 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRAF4 Antibody

CSB-PA788984-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TRAF4 Antibody

DF4728 200ul
EUR 304
Description: TRAF4 Antibody detects endogenous levels of total TRAF4.

TRAF4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRAF4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAF4. Recognizes TRAF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TRAF4 Antibody

ABD4728 100 ug
EUR 438

Polyclonal TRAF4 Antibody (C-term)

APR04065G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAF4 (C-term). This antibody is tested and proven to work in the following applications:

TRAF4 Conjugated Antibody

C35240 100ul
EUR 397

TRAF4 Conjugated Antibody

C47224 100ul
EUR 397

anti- TRAF4 antibody

FNab08919 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: TNF receptor-associated factor 4
  • Uniprot ID: Q9BUZ4
  • Gene ID: 9618
  • Research Area: Stem Cells, Signal Transduction, Developmental biology
Description: Antibody raised against TRAF4

Anti-TRAF4 Antibody

PA2009 100ug/vial
EUR 334

Anti-TRAF4 antibody

PAab08919 100 ug
EUR 386

Anti-TRAF4 antibody

STJ29127 100 µl
EUR 277
Description: This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined.

Anti-TRAF4 antibody

STJ96084 200 µl
EUR 197
Description: Rabbit polyclonal to TRAF4.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA16433 50 ul
EUR 363
Description: Mouse polyclonal to TRAF4


YF-PA16434 50 ug
EUR 363
Description: Mouse polyclonal to TRAF4


YF-PA16435 100 ug
EUR 403
Description: Rabbit polyclonal to TRAF4

TRAF4 Blocking Peptide

33R-4877 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAF4 antibody, catalog no. 70R-10513

TRAF4 Blocking Peptide

DF4728-BP 1mg
EUR 195

TRAF4 cloning plasmid

CSB-CL024152HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgcctggcttcgactacaagttcctggagaagcccaagcgacggctgctgtgcccactgtgcgggaagcccatgcgcgagcctgtgcaggtttccacctgcggccaccgtttctgcgatacctgcctgcaggagttcctcagtgaaggagtcttcaagtgccctgaggaccagc
  • Show more
Description: A cloning plasmid for the TRAF4 gene.

Anti-TRAF4 (3F6)

YF-MA11191 100 ug
EUR 363
Description: Mouse monoclonal to TRAF4

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4)


EF003782 96 Tests
EUR 689

Mouse TRAF4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRAF4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRAF4 Recombinant Protein (Rat)

RP234506 100 ug Ask for price

pLVX-Puro-TRAF4 Plasmid

PVTB00713-4a 2 ug
EUR 356

TRAF4 Recombinant Protein (Human)

RP032764 100 ug Ask for price

TRAF4 Recombinant Protein (Mouse)

RP180848 100 ug Ask for price

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with APC.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with Biotin.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with Cy3.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with FITC.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with HRP.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with PE.

TNF Receptor Associated Factor 4 (TRAF4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRAF4 (Gln193~Asp444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human TNF Receptor Associated Factor 4 (TRAF4). This antibody is labeled with APC-Cy7.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

TNF Receptor Associated Factor 4 (TRAF4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

abx145408-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

abx028567-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

abx028567-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

abx238919-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TNF Receptor-Associated Factor 4 (TRAF4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

TNF Receptor Associated Factor 4 (TRAF4) Antibody

abx331218-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

TNF Receptor Associated Factor 4 (TRAF4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal TRAF4 Antibody (monoclonal) (M01), Clone: 3F6

AMM04241G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRAF4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F6. This antibody is applicable in WB and IHC, E

Traf4 ORF Vector (Rat) (pORF)

ORF078170 1.0 ug DNA
EUR 506

TRAF4 ORF Vector (Human) (pORF)

ORF010922 1.0 ug DNA
EUR 95

Traf4 ORF Vector (Mouse) (pORF)

ORF060284 1.0 ug DNA
EUR 506

Traf4 sgRNA CRISPR Lentivector set (Mouse)

K5001001 3 x 1.0 ug
EUR 339

Traf4 sgRNA CRISPR Lentivector set (Rat)

K6144401 3 x 1.0 ug
EUR 339

TRAF4 sgRNA CRISPR Lentivector set (Human)

K2433201 3 x 1.0 ug
EUR 339

Traf4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5001002 1.0 ug DNA
EUR 154

Traf4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5001003 1.0 ug DNA
EUR 154

Traf4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5001004 1.0 ug DNA
EUR 154

Traf4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6144402 1.0 ug DNA
EUR 154

Traf4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6144403 1.0 ug DNA
EUR 154

Traf4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6144404 1.0 ug DNA
EUR 154

TRAF4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2433202 1.0 ug DNA
EUR 154

TRAF4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2433203 1.0 ug DNA
EUR 154

TRAF4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2433204 1.0 ug DNA
EUR 154

TRAF4 Protein Vector (Rat) (pPB-C-His)

PV312678 500 ng
EUR 603

TRAF4 Protein Vector (Rat) (pPB-N-His)

PV312679 500 ng
EUR 603

TRAF4 Protein Vector (Rat) (pPM-C-HA)

PV312680 500 ng
EUR 603

TRAF4 Protein Vector (Rat) (pPM-C-His)

PV312681 500 ng
EUR 603

TRAF4 Protein Vector (Mouse) (pPB-C-His)

PV241134 500 ng
EUR 603

TRAF4 Protein Vector (Mouse) (pPB-N-His)

PV241135 500 ng
EUR 603

TRAF4 Protein Vector (Mouse) (pPM-C-HA)

PV241136 500 ng
EUR 603

TRAF4 Protein Vector (Mouse) (pPM-C-His)

PV241137 500 ng
EUR 603

Recombinant TNF Receptor Associated Factor 4 (TRAF4)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BUZ4
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: 8.5
Description: Recombinant Human TNF Receptor Associated Factor 4 expressed in: E.coli

TRAF4 Protein Vector (Human) (pPB-C-His)

PV043685 500 ng
EUR 329

TRAF4 Protein Vector (Human) (pPB-N-His)

PV043686 500 ng
EUR 329

TRAF4 Protein Vector (Human) (pPM-C-HA)

PV043687 500 ng
EUR 329

TRAF4 Protein Vector (Human) (pPM-C-His)

PV043688 500 ng
EUR 329

pPLK/GFP+Puro-TRAF4 shRNA-2 Plasmid

PVTB00713-3a 2 ug
EUR 356

pPLK/GFP+Puro-TRAF4 shRNA-1 Plasmid

PVTB00713-3b 2 ug
EUR 356

Traf4 3'UTR Luciferase Stable Cell Line

TU121023 1.0 ml Ask for price

Traf4 3'UTR GFP Stable Cell Line

TU171023 1.0 ml Ask for price

Traf4 3'UTR Luciferase Stable Cell Line

TU222376 1.0 ml Ask for price

TRAF4 3'UTR GFP Stable Cell Line

TU076212 1.0 ml
EUR 1394