Order Now: brent@sdlifesciences.com
TLK1 Polyclonal Antibody |
ABP57117-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764
- Applications tips:
|
Description: A polyclonal antibody for detection of TLK1 from Human, Mouse. This TLK1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764 |
TLK1 Polyclonal Antibody |
ABP57117-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764
- Applications tips:
|
Description: A polyclonal antibody for detection of TLK1 from Human, Mouse. This TLK1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764 |
TLK1 Polyclonal Antibody |
ABP57117-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764
- Applications tips:
|
Description: A polyclonal antibody for detection of TLK1 from Human, Mouse. This TLK1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TLK1 around the non-phosphorylation site of S764 |
TLK1 Polyclonal Antibody |
ES8116-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TLK1 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA |
TLK1 Polyclonal Antibody |
ES8116-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TLK1 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA |
TLK1 Polyclonal Antibody |
ES3616-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TLK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TLK1 Polyclonal Antibody |
ES3616-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TLK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TLK1 Rabbit pAb |
A8913-100ul |
Abclonal |
100 ul |
EUR 308 |
TLK1 Rabbit pAb |
A8913-200ul |
Abclonal |
200 ul |
EUR 459 |
TLK1 Rabbit pAb |
A8913-20ul |
Abclonal |
20 ul |
Ask for price |
TLK1 Rabbit pAb |
A8913-50ul |
Abclonal |
50 ul |
Ask for price |
TLK1 Rabbit pAb |
A14831-100ul |
Abclonal |
100 ul |
EUR 308 |
TLK1 Rabbit pAb |
A14831-200ul |
Abclonal |
200 ul |
EUR 459 |
TLK1 Rabbit pAb |
A14831-20ul |
Abclonal |
20 ul |
EUR 183 |
TLK1 Rabbit pAb |
A14831-50ul |
Abclonal |
50 ul |
EUR 223 |
TLK1 antibody |
70R-2084 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TLK1 antibody raised against the middle region of TLK1 |
TLK1 antibody |
70R-20846 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TLK1 antibody |
TLK1 antibody |
70R-31541 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal TLK1 antibody |
TLK1 Antibody |
35297-100ul |
SAB |
100ul |
EUR 252 |
TLK1 Antibody |
35297-50ul |
SAB |
50ul |
EUR 187 |
TLK1 Antibody |
1-CSB-PA004303 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
TLK1 Antibody |
1-CSB-PA080080 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000 |
TLK1 Antibody |
DF4792 |
Affbiotech |
200ul |
EUR 304 |
Description: TLK1 Antibody detects endogenous levels of total TLK1. |
TLK1 Antibody |
CSB-PA178566- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
TLK1 Antibody |
CSB-PA178566-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
TLK1 antibody |
70R-50750 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal TLK1 antibody |
TLK1 antibody |
70R-50751 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal TLK1 antibody |
TLK1 antibody |
70R-51356 |
Fitzgerald |
100 ul |
EUR 287 |
Description: Purified Polyclonal TLK1 antibody |
TLK1 antibody |
70R-5667 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TLK1 antibody raised against the N terminal of TLK1 |
TLK1 Antibody |
1-CSB-PA023590GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TLK1. Recognizes TLK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TLK1 Antibody |
20-abx325138 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal TLK1 Antibody (aa730-779) |
AMM08221G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLK1 (aa730-779). This antibody is tested and proven to work in the following applications: |
Polyclonal TLK1 Antibody (C-term) |
APR14414G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLK1 (C-term). This antibody is tested and proven to work in the following applications: |
TLK1 (Phospho-Ser764) Polyclonal Conjugated Antibody |
C12419 |
SAB |
100ul |
EUR 397 |
Anti-TLK1 Antibody |
A05635-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal TLK1 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
TLK1 (pS743) Antibody |
20-abx009809 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
TLK1 (pS764) Antibody |
abx219001-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Mouse Tlk1 Antibody |
abx029447-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Tlk1 Antibody |
abx029447-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TLK1 Conjugated Antibody |
C35297 |
SAB |
100ul |
EUR 397 |
anti- TLK1 antibody |
FNab08724 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: tousled-like kinase 1
- Uniprot ID: Q9UKI8
- Gene ID: 9874
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against TLK1 |
Anti-TLK1 antibody |
STJ111477 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. |
Anti-TLK1 antibody |
STJ117031 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. |
Anti-TLK1 antibody |
STJ96037 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to TLK1. |
Anti-TLK1 antibody |
STJ96038 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to TLK1. |
TLK1 siRNA |
20-abx936873 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TLK1 siRNA |
20-abx936874 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TLK1 |
YF-PA27462 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TLK1 |
TLK1 (Phospho-Ser764) Antibody |
12419-100ul |
SAB |
100ul |
EUR 252 |
TLK1 (Phospho-Ser764) Antibody |
12419-50ul |
SAB |
50ul |
EUR 187 |
Phospho-TLK1 (Ser743) Antibody |
AF2425 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-TLK1 (Ser743) Antibody detects endogenous levels of TLK1. |
Phospho-TLK1 (Ser764) Antibody |
AF8029 |
Affbiotech |
200ul |
EUR 376 |
Description: TLK1 (Phospho-Ser764) Antibody detects endogenous levels of TLK1 only when phosphorylated at Ser764. |
TLK1 Blocking Peptide |
33R-2724 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLK1 antibody, catalog no. 70R-5667 |
TLK1 Blocking Peptide |
33R-8120 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLK1 antibody, catalog no. 70R-2084 |
TLK1 cloning plasmid |
CSB-CL891950HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2301
- Sequence: atgagtgtccaaagtagcagtggaagtttggaggggccgccatcttggtcccagctctccacgtctccaaccccgggctcggcggcggcggccaggtccctgctgaatcacacgccgccatccgggaggcccagggaaggtgcaatggatgagcttcatagtctggatccaagaa
- Show more
|
Description: A cloning plasmid for the TLK1 gene. |
TLK1 Blocking Peptide |
DF4792-BP |
Affbiotech |
1mg |
EUR 195 |
TLK1 Blocking Peptide |
20-abx063625 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TLK1 Blocking Peptide |
20-abx063626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-TLK1 (4B3) |
YF-MA11218 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TLK1 |
TLK1 (pS743) Blocking Peptide |
20-abx064231 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human TLK1 shRNA Plasmid |
20-abx956622 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TLK1 shRNA Plasmid |
20-abx981608 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Tousled-Like Kinase 1 (TLK1) Antibody |
20-abx116135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-TLK1 (Ser743) Blocking Peptide |
AF2425-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-TLK1 (Ser764) Blocking Peptide |
AF8029-BP |
Affbiotech |
1mg |
EUR 195 |
Tlk1 ORF Vector (Rat) (pORF) |
ORF077747 |
ABM |
1.0 ug DNA |
EUR 506 |
TLK1 ORF Vector (Human) (pORF) |
ORF010560 |
ABM |
1.0 ug DNA |
EUR 95 |
Tlk1 ORF Vector (Mouse) (pORF) |
ORF059644 |
ABM |
1.0 ug DNA |
EUR 506 |
Tlk1 sgRNA CRISPR Lentivector set (Mouse) |
K4996601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tlk1 sgRNA CRISPR Lentivector set (Rat) |
K6387101 |
ABM |
3 x 1.0 ug |
EUR 339 |
TLK1 sgRNA CRISPR Lentivector set (Human) |
K2378801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
20-abx008381 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
20-abx008382 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
20-abx015172 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
20-abx124062 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
abx238724-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Serine/Threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
abx331211-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase Tousled-Like 1 (TLK1) Antibody |
20-abx323966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tlk1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4996602 |
ABM |
1.0 ug DNA |
EUR 154 |
Tlk1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4996603 |
ABM |
1.0 ug DNA |
EUR 154 |
Tlk1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4996604 |
ABM |
1.0 ug DNA |
EUR 154 |
Tlk1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6387102 |
ABM |
1.0 ug DNA |
EUR 154 |
Tlk1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6387103 |
ABM |
1.0 ug DNA |
EUR 154 |
Tlk1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6387104 |
ABM |
1.0 ug DNA |
EUR 154 |
TLK1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2378802 |
ABM |
1.0 ug DNA |
EUR 154 |
TLK1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2378803 |
ABM |
1.0 ug DNA |
EUR 154 |
TLK1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2378804 |
ABM |
1.0 ug DNA |
EUR 154 |
TLK1 Protein Vector (Rat) (pPB-C-His) |
PV310986 |
ABM |
500 ng |
EUR 603 |
TLK1 Protein Vector (Rat) (pPB-N-His) |
PV310987 |
ABM |
500 ng |
EUR 603 |
TLK1 Protein Vector (Rat) (pPM-C-HA) |
PV310988 |
ABM |
500 ng |
EUR 603 |
TLK1 Protein Vector (Rat) (pPM-C-His) |
PV310989 |
ABM |
500 ng |
EUR 603 |
TLK1 Protein Vector (Human) (pPB-C-His) |
PV042237 |
ABM |
500 ng |
EUR 329 |
TLK1 Protein Vector (Human) (pPB-N-His) |
PV042238 |
ABM |
500 ng |
EUR 329 |
TLK1 Protein Vector (Human) (pPM-C-HA) |
PV042239 |
ABM |
500 ng |
EUR 329 |
TLK1 Protein Vector (Human) (pPM-C-His) |
PV042240 |
ABM |
500 ng |
EUR 329 |
TLK1 Protein Vector (Mouse) (pPB-C-His) |
PV238574 |
ABM |
500 ng |
EUR 1065 |
TLK1 Protein Vector (Mouse) (pPB-N-His) |
PV238575 |
ABM |
500 ng |
EUR 1065 |
TLK1 Protein Vector (Mouse) (pPM-C-HA) |
PV238576 |
ABM |
500 ng |
EUR 1065 |
TLK1 Protein Vector (Mouse) (pPM-C-His) |
PV238577 |
ABM |
500 ng |
EUR 1065 |
Tlk1 3'UTR Luciferase Stable Cell Line |
TU120536 |
ABM |
1.0 ml |
Ask for price |
Tlk1 3'UTR GFP Stable Cell Line |
TU170536 |
ABM |
1.0 ml |
Ask for price |
Tlk1 3'UTR Luciferase Stable Cell Line |
TU221929 |
ABM |
1.0 ml |
Ask for price |
TLK1 3'UTR GFP Stable Cell Line |
TU075630 |
ABM |
1.0 ml |
EUR 2333 |
Tlk1 3'UTR GFP Stable Cell Line |
TU271929 |
ABM |
1.0 ml |
Ask for price |
TLK1 3'UTR Luciferase Stable Cell Line |
TU025630 |
ABM |
1.0 ml |
EUR 2333 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |