TBP Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

TBP Polyclonal Antibody

ES8275-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

TBP Polyclonal Antibody

ES8275-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

TBP Polyclonal Antibody

ABP57276-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TBP Polyclonal Antibody

ABP57276-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TBP Polyclonal Antibody

ABP57276-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TBP Rabbit pAb

A16436-100ul 100 ul
EUR 308

TBP Rabbit pAb

A16436-200ul 200 ul
EUR 459

TBP Rabbit pAb

A16436-20ul 20 ul
EUR 183

TBP Rabbit pAb

A16436-50ul 50 ul
EUR 223

TBP Rabbit pAb

A1423-100ul 100 ul
EUR 308

TBP Rabbit pAb

A1423-200ul 200 ul
EUR 459

TBP Rabbit pAb

A1423-20ul 20 ul Ask for price

TBP Rabbit pAb

A1423-50ul 50 ul Ask for price

Polyclonal TBP Antibody (Center)

APR13719G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBP (Center). This antibody is tested and proven to work in the following applications:

Anti-TBP/Tata Binding Protein Tbp Rabbit Monoclonal Antibody

M00302 100ug/vial
EUR 397
Description: Rabbit Monoclonal TBP/Tata Binding Protein Tbp Antibody. Validated in WB and tested in Human, Mouse, Rat.

Rabbit TBP ELISA Kit

ERTT0104 96Tests
EUR 521

TBP Antibody

AF5476 200ul
EUR 304
Description: TBP Antibody detects endogenous levels of total TBP.

TBP Antibody

ABF5476 100 ug
EUR 438

TBP antibody

70R-20720 50 ul
EUR 435
Description: Rabbit polyclonal TBP antibody

TBP antibody

70R-31629 100 ug
EUR 327
Description: Rabbit polyclonal TBP antibody

TBP Antibody

ABD3115 100 ug
EUR 438

TBP Antibody

ABD6915 100 ug
EUR 438

TBP antibody

38396-100ul 100ul
EUR 252

TBP Antibody

33709-100ul 100ul
EUR 252

TBP Antibody

33709-50ul 50ul
EUR 187

TBP Antibody

43335-100ul 100ul
EUR 252

TBP antibody

10R-1278 100 ug
EUR 512
Description: Mouse monoclonal TBP antibody

TBP antibody

70R-14073 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal TBP antibody

TBP Antibody

DF6915 200ul
EUR 304
Description: TBP Antibody detects endogenous levels of total TBP.

TBP Antibody

DF3115 200ul
EUR 304
Description: TBP Antibody detects endogenous levels of total TBP.

TBP Antibody

1-CSB-PA004265
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

TBP Antibody

CSB-PA276652-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TBP Antibody

CSB-PA276652-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TBP Antibody

1-CSB-PA080259
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200

TBP Antibody

1-CSB-PA023239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TBP Antibody

1-CSB-PA023239HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

[KO Validated] TBP Rabbit pAb

A2192-100ul 100 ul
EUR 410

[KO Validated] TBP Rabbit pAb

A2192-200ul 200 ul
EUR 571

[KO Validated] TBP Rabbit pAb

A2192-20ul 20 ul
EUR 221

[KO Validated] TBP Rabbit pAb

A2192-50ul 50 ul
EUR 287

TBP Conjugated Antibody

C43335 100ul
EUR 397

Monoclonal TBP Antibody

APR13717G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human TBP. The antibodies are raised in Mouse. This antibody is applicable in WB

TBP Conjugated Antibody

C33709 100ul
EUR 397

anti- TBP antibody

FNab08525 100µg
EUR 548.75
  • Immunogen: TATA box binding protein
  • Uniprot ID: P20226
  • Gene ID: 6908
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBP

anti- TBP antibody

FNab08526 100µg
EUR 548.75
  • Immunogen: TATA box binding protein
  • Uniprot ID: P20226
  • Gene ID: 6908
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBP

anti- TBP antibody

FNab08527 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:5000
  • IP: 1:500-1:1000
  • Immunogen: TATA box binding protein
  • Uniprot ID: P20226
  • Gene ID: 6908
  • Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against TBP

Anti-TBP antibody

PAab08525 100 ug
EUR 386

Anti-TBP antibody

PAab08526 100 ug
EUR 386

Anti-TBP antibody

STJ97481 200 µl
EUR 197
Description: Rabbit polyclonal to TBP.

Anti-TBP antibody

STJ25783 100 µl
EUR 277
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene.

Anti-TBP antibody

STJ25784 100 µl
EUR 413
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene.

Anti-TBP antibody

STJ118876 100 µl
EUR 277

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse)

4-PAB703Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP)

TBP siRNA

20-abx936244
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TBP siRNA

20-abx936245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal TBP monoclonal antibody

APR13720G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TBP monoclonal. The antibodies are raised in Mouse. This antibody is applicable in WB

Tbp-Like 1 Antibody

20-abx116011
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TBP Antibody, HRP conjugated

1-CSB-PA023239HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TBP Antibody, FITC conjugated

1-CSB-PA023239HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TBP Antibody, Biotin conjugated

1-CSB-PA023239HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TBP Antibody (Monoclonal)

CI1132 100ul
EUR 491
Description: Mouse Monoclonal TBP Antibody (Monoclonal). Validated in ChIP, ChIP-qPCR, ChIP-seq, IHC and tested in Human, Mouse.

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), APC

4-PAB703Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with APC.

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), Biotinylated

4-PAB703Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with Biotin.

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), Cy3

4-PAB703Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with Cy3.

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), FITC

4-PAB703Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with FITC.

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), HRP

4-PAB703Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with HRP.

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), PE

4-PAB703Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with PE.

Monoclonal TBP Antibody, Clone: 830CT4.3.3

APR13716G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human TBP. The antibodies are raised in Mouse and are from clone 830CT4.3.3. This antibody is applicable in IHC-P, WB, E

TATA Binding Protein (TBP) Antibody

20-abx174719
  • EUR 328.00
  • EUR 829.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

TBP Blocking Peptide

AF5476-BP 1mg
EUR 195

TBP cloning plasmid

CSB-CL023239HU-10ug 10ug
EUR 233
  • Formulation: 10 ĂŽÂĽg plasmid + 200ĂŽÂĽl Glycerol
  • Length: 867
  • Sequence: ATGGATCAGAACAACAGCCTGCCACCTTACGCTCAGGGCTTGGCCTCCCCTCAGGGTGCCATGACTCCCGGAATCCCTATCTTTAGTCCAATGATGCCTTATGGCACTGGACTGACCCCACAGCCTATTCAGAACACCAATAGTCTGTCTATTTTGGAAGAGCAACAAAGGCAGGC
  • Show more
Description: A cloning plasmid for the TBP gene.

TBP Blocking Peptide

DF6915-BP 1mg
EUR 195

TBP Blocking Peptide

DF3115-BP 1mg
EUR 195

Recombinant Human TBP

P0268 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P20226
Description: Recombinant Human protein for TBP

Polyclonal TBP /Transcription factor IID (isoform1) Antibody (N-Term)

APR13715G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TBP /Transcription factor IID (isoform1) (N-Term). This antibody is tested and proven to work in the following applications:

TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB703Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TBP (Pro8~Thr316)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with APC-Cy7.

Rabbit TATA Box Binding Protein (TBP) ELISA Kit

abx362779-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Polyclonal TBP /Transcription factor IID (aa39-50) Antibody (internal region)

APR13714G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TBP /Transcription factor IID (aa39-50) (internal region). This antibody is tested and proven to work in the following applications:

Monoclonal TBP Antibody (Ascites), Clone: 830CT4.3.3

APR13718G 0.1 ml
EUR 484
Description: A Monoclonal antibody against Human TBP (Ascites). The antibodies are raised in Mouse and are from clone 830CT4.3.3. This antibody is applicable in WB, E

TBP/TATA Binding Protein Monoclonal Antibody

EM1216-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

TBP/TATA Binding Protein Monoclonal Antibody

EM1216-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

TBP/TATA Binding Protein Monoclonal Antibody

EM1220-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

TBP/TATA Binding Protein Monoclonal Antibody

EM1220-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

Tata Box Binding Protein (TBP) Antibody

20-abx115993
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx121773
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx001231
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx001804
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TBP-Associated Factor 172 (TAF172) Antibody

20-abx141802
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx159704
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx159705
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx147252-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx147253-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx147435-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx134197
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx134198
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx136101
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx101922
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TATA Box Binding Protein (TBP) Antibody

abx034786-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx034787-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx034787-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx032930-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

abx032930-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx013423
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

TBP/TATA Binding Protein Monoclonal Antibody

ABM40219-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

TBP/TATA Binding Protein Monoclonal Antibody

ABM40219-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

TBP/TATA Binding Protein Monoclonal Antibody

ABM40219-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

TBP/TATA Binding Protein Monoclonal Antibody

ABM40223-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

TBP/TATA Binding Protein Monoclonal Antibody

ABM40223-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

TBP/TATA Binding Protein Monoclonal Antibody

ABM40223-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

TATA Box Binding Protein (TBP) Antibody

20-abx329547
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

TATA Box Binding Protein (TBP) Antibody

20-abx329737
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.