Order Now: brent@sdlifesciences.com
TBP Polyclonal Antibody |
ES8275-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
TBP Polyclonal Antibody |
ES8275-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
TBP Polyclonal Antibody |
ABP57276-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
TBP Polyclonal Antibody |
ABP57276-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
TBP Polyclonal Antibody |
ABP57276-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TBP from Human, Mouse, Rat. This TBP antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
TBP Rabbit pAb |
A16436-100ul |
Abclonal |
100 ul |
EUR 308 |
TBP Rabbit pAb |
A16436-200ul |
Abclonal |
200 ul |
EUR 459 |
TBP Rabbit pAb |
A16436-20ul |
Abclonal |
20 ul |
EUR 183 |
TBP Rabbit pAb |
A16436-50ul |
Abclonal |
50 ul |
EUR 223 |
TBP Rabbit pAb |
A1423-100ul |
Abclonal |
100 ul |
EUR 308 |
TBP Rabbit pAb |
A1423-200ul |
Abclonal |
200 ul |
EUR 459 |
TBP Rabbit pAb |
A1423-20ul |
Abclonal |
20 ul |
Ask for price |
TBP Rabbit pAb |
A1423-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal TBP Antibody (Center) |
APR13719G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBP (Center). This antibody is tested and proven to work in the following applications: |
Anti-TBP/Tata Binding Protein Tbp Rabbit Monoclonal Antibody |
M00302 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal TBP/Tata Binding Protein Tbp Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Rabbit TBP ELISA Kit |
ERTT0104 |
Abclonal |
96Tests |
EUR 521 |
TBP Antibody |
AF5476 |
Affbiotech |
200ul |
EUR 304 |
Description: TBP Antibody detects endogenous levels of total TBP. |
TBP antibody |
70R-20720 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TBP antibody |
TBP antibody |
70R-31629 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal TBP antibody |
TBP antibody |
38396-100ul |
SAB |
100ul |
EUR 252 |
TBP Antibody |
33709-100ul |
SAB |
100ul |
EUR 252 |
TBP Antibody |
33709-50ul |
SAB |
50ul |
EUR 187 |
TBP Antibody |
43335-100ul |
SAB |
100ul |
EUR 252 |
TBP antibody |
10R-1278 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal TBP antibody |
TBP antibody |
70R-14073 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal TBP antibody |
TBP Antibody |
DF6915 |
Affbiotech |
200ul |
EUR 304 |
Description: TBP Antibody detects endogenous levels of total TBP. |
TBP Antibody |
DF3115 |
Affbiotech |
200ul |
EUR 304 |
Description: TBP Antibody detects endogenous levels of total TBP. |
TBP Antibody |
1-CSB-PA004265 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000 |
TBP Antibody |
CSB-PA276652- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
TBP Antibody |
CSB-PA276652-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
TBP Antibody |
1-CSB-PA080259 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200 |
TBP Antibody |
1-CSB-PA023239GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TBP. Recognizes TBP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TBP Antibody |
1-CSB-PA023239HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
[KO Validated] TBP Rabbit pAb |
A2192-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] TBP Rabbit pAb |
A2192-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] TBP Rabbit pAb |
A2192-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] TBP Rabbit pAb |
A2192-50ul |
Abclonal |
50 ul |
EUR 287 |
TBP Conjugated Antibody |
C43335 |
SAB |
100ul |
EUR 397 |
Monoclonal TBP Antibody |
APR13717G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human TBP. The antibodies are raised in Mouse. This antibody is applicable in WB |
TBP Conjugated Antibody |
C33709 |
SAB |
100ul |
EUR 397 |
anti- TBP antibody |
FNab08525 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: TATA box binding protein
- Uniprot ID: P20226
- Gene ID: 6908
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against TBP |
anti- TBP antibody |
FNab08526 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: TATA box binding protein
- Uniprot ID: P20226
- Gene ID: 6908
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against TBP |
anti- TBP antibody |
FNab08527 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:2000-1:5000
- IP: 1:500-1:1000
- Immunogen: TATA box binding protein
- Uniprot ID: P20226
- Gene ID: 6908
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against TBP |
Anti-TBP antibody |
STJ97481 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to TBP. |
Anti-TBP antibody |
STJ25783 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. |
Anti-TBP antibody |
STJ25784 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse) |
4-PAB703Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP) |
TBP siRNA |
20-abx936244 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBP siRNA |
20-abx936245 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal TBP monoclonal antibody |
APR13720G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human TBP monoclonal. The antibodies are raised in Mouse. This antibody is applicable in WB |
Tbp-Like 1 Antibody |
20-abx116011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TBP Antibody, HRP conjugated |
1-CSB-PA023239HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TBP Antibody, FITC conjugated |
1-CSB-PA023239HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TBP Antibody, Biotin conjugated |
1-CSB-PA023239HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TBP. Recognizes TBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-TBP Antibody (Monoclonal) |
CI1132 |
BosterBio |
100ul |
EUR 491 |
Description: Mouse Monoclonal TBP Antibody (Monoclonal). Validated in ChIP, ChIP-qPCR, ChIP-seq, IHC and tested in Human, Mouse. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), APC |
4-PAB703Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with APC. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB703Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with Biotin. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), Cy3 |
4-PAB703Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with Cy3. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), FITC |
4-PAB703Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with FITC. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), HRP |
4-PAB703Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with HRP. |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), PE |
4-PAB703Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with PE. |
Monoclonal TBP Antibody, Clone: 830CT4.3.3 |
APR13716G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human TBP. The antibodies are raised in Mouse and are from clone 830CT4.3.3. This antibody is applicable in IHC-P, WB, E |
TATA Binding Protein (TBP) Antibody |
20-abx174719 |
Abbexa |
-
EUR 328.00
-
EUR 829.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
TBP Blocking Peptide |
AF5476-BP |
Affbiotech |
1mg |
EUR 195 |
TBP cloning plasmid |
CSB-CL023239HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 ĂŽÂĽg plasmid + 200ĂŽÂĽl Glycerol
- Length: 867
- Sequence: ATGGATCAGAACAACAGCCTGCCACCTTACGCTCAGGGCTTGGCCTCCCCTCAGGGTGCCATGACTCCCGGAATCCCTATCTTTAGTCCAATGATGCCTTATGGCACTGGACTGACCCCACAGCCTATTCAGAACACCAATAGTCTGTCTATTTTGGAAGAGCAACAAAGGCAGGC
- Show more
|
Description: A cloning plasmid for the TBP gene. |
TBP Blocking Peptide |
DF6915-BP |
Affbiotech |
1mg |
EUR 195 |
TBP Blocking Peptide |
DF3115-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant Human TBP |
P0268 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: P20226
|
Description: Recombinant Human protein for TBP |
Polyclonal TBP /Transcription factor IID (isoform1) Antibody (N-Term) |
APR13715G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TBP /Transcription factor IID (isoform1) (N-Term). This antibody is tested and proven to work in the following applications: |
TATA Binding Protein (TBP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB703Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TBP (Pro8~Thr316)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse TATA Binding Protein (TBP). This antibody is labeled with APC-Cy7. |
Rabbit TATA Box Binding Protein (TBP) ELISA Kit |
abx362779-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Polyclonal TBP /Transcription factor IID (aa39-50) Antibody (internal region) |
APR13714G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TBP /Transcription factor IID (aa39-50) (internal region). This antibody is tested and proven to work in the following applications: |
Monoclonal TBP Antibody (Ascites), Clone: 830CT4.3.3 |
APR13718G |
Leading Biology |
0.1 ml |
EUR 484 |
Description: A Monoclonal antibody against Human TBP (Ascites). The antibodies are raised in Mouse and are from clone 830CT4.3.3. This antibody is applicable in WB, E |
TBP/TATA Binding Protein Monoclonal Antibody |
EM1216-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA |
TBP/TATA Binding Protein Monoclonal Antibody |
EM1216-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA |
TBP/TATA Binding Protein Monoclonal Antibody |
EM1220-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for IHC |
TBP/TATA Binding Protein Monoclonal Antibody |
EM1220-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Mouse Monoclonal antibody against TBP/TATA Binding Protein from Human/ Rat/ Mouse. This antibody is tested and validated for IHC |
Tata Box Binding Protein (TBP) Antibody |
20-abx115993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx121773 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx001231 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx001804 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
TBP-Associated Factor 172 (TAF172) Antibody |
20-abx141802 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx159704 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx159705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx147252-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx147253-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx147435-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx134197 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx134198 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx136101 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx101922 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx034786-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx034787-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx034787-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx032930-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
abx032930-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx013423 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
TBP/TATA Binding Protein Monoclonal Antibody |
ABM40219-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
TBP/TATA Binding Protein Monoclonal Antibody |
ABM40219-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
TBP/TATA Binding Protein Monoclonal Antibody |
ABM40219-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
TBP/TATA Binding Protein Monoclonal Antibody |
ABM40223-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
TBP/TATA Binding Protein Monoclonal Antibody |
ABM40223-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
TBP/TATA Binding Protein Monoclonal Antibody |
ABM40223-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of TBP/TATA Binding Protein from Human, Mouse, Rat. This TBP/TATA Binding Protein antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
TATA Box Binding Protein (TBP) Antibody |
20-abx329547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA Box Binding Protein (TBP) Antibody |
20-abx329737 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|