SSTR2 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

SSTR2 Polyclonal Antibody
ABP57449-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human SSTR2
  • Applications tips:
Description: A polyclonal antibody for detection of SSTR2 from Human, Mouse, Rat. This SSTR2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SSTR2
SSTR2 Polyclonal Antibody
ABP57449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human SSTR2
  • Applications tips:
Description: A polyclonal antibody for detection of SSTR2 from Human, Mouse, Rat. This SSTR2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SSTR2
SSTR2 Polyclonal Antibody
ES8442-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SSTR2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SSTR2 Polyclonal Antibody
ES8442-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SSTR2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SSTR2 Rabbit pAb
A3135-100ul 100 ul
EUR 308
SSTR2 Rabbit pAb
A3135-200ul 200 ul
EUR 459
SSTR2 Rabbit pAb
A3135-20ul 20 ul
EUR 183
SSTR2 Rabbit pAb
A3135-50ul 50 ul
EUR 223
SSTR2 Rabbit pAb
A15101-100ul 100 ul
EUR 308
SSTR2 Rabbit pAb
A15101-200ul 200 ul
EUR 459
SSTR2 Rabbit pAb
A15101-20ul 20 ul
EUR 183
SSTR2 Rabbit pAb
A15101-50ul 50 ul
EUR 223
SSTR2 antibody
70R-14231 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal SSTR2 antibody
SSTR2 Antibody
37257-100ul 100ul
EUR 252
SSTR2 antibody
38600-100ul 100ul
EUR 252
SSTR2 Antibody
1-CSB-PA617002
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
SSTR2 Antibody
DF7206 200ul
EUR 304
Description: SSTR2 Antibody detects endogenous levels of total SSTR2.
SSTR2 Antibody
1-CSB-PA260413
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
SSTR2 antibody
70R-9813 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SSTR2 antibody
SSTR2 antibody
70R-51336 100 ul
EUR 244
Description: Purified Polyclonal SSTR2 antibody
SSTR2 Antibody
1-CSB-PA022725LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
SSTR2 Antibody
ABD7206 100 ug
EUR 438
Polyclonal SSTR2 Antibody (C-Terminus)
APR10246G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal SSTR2 Antibody (Cytoplasmic Domain)
APR10247G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal SSTR2 Antibody (Extracellular Domain)
APR10248G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
Polyclonal SSTR2 antibody - middle region
APR10250G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal SSTR2 Antibody - C-terminal region
APR10249G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SSTR2 - C-terminal region. This antibody is tested and proven to work in the following applications:
SSTR2 Conjugated Antibody
C37257 100ul
EUR 397
SSTR2 Conjugated Antibody
C38600 100ul
EUR 397
anti- SSTR2 antibody
FNab08253 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:100
  • Immunogen: somatostatin receptor 2
  • Uniprot ID: P30874
  • Gene ID: 6752
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against SSTR2
Anti-SSTR2 antibody
PAab08253 100 ug
EUR 412
Anti-SSTR2 antibody
STJ25706 100 µl
EUR 277
Description: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney.
Anti-SSTR2 antibody
STJ117295 100 µl
EUR 277
Description: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney.
Anti-SSTR2 antibody
STJ97705 200 µl
EUR 197
Description: Rabbit polyclonal to SSTR2.
SSTR2 siRNA
20-abx905297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SSTR2 siRNA
20-abx935278
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SSTR2 siRNA
20-abx935279
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SSTR2 Antibody, HRP conjugated
1-CSB-PA022725LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SSTR2 Antibody, FITC conjugated
1-CSB-PA022725LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SSTR2 Antibody, Biotin conjugated
1-CSB-PA022725LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSTR2. Recognizes SSTR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SSTR2 Blocking Peptide
33R-8247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SSTR2 antibody, catalog no. 70R-9813
SSTR2 Blocking Peptide
DF7206-BP 1mg
EUR 195
SSTR2 Blocking Peptide
20-abx064211
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
SSTR2 cloning plasmid
CSB-CL022725HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggacatggcggatgagccactcaatggaagccacacatggctatccattccatttgacctcaatggctctgtggtgtcaaccaacacctcaaaccagacagagccgtactatgacctgacaagcaatgcagtcctcacattcatctattttgtggtctgcatcattgggttgt
  • Show more
Description: A cloning plasmid for the SSTR2 gene.
Somatostatin Receptor 2 (SSTR2) Antibody
20-abx214697
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Somatostatin Receptor 2 (SSTR2) Antibody
20-abx214723
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Somatostatin Receptor Type 2 (SSTR2) Antibody
20-abx007819
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Somatostatin Receptor Type 2 (SSTR2) Antibody
abx238253-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Somatostatin Receptor Type 2 (SSTR2) Antibody
20-abx317864
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Somatostatin Receptor Type 2 (SSTR2) Antibody
20-abx002252
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-Somatostatin Receptor 2/SSTR2 Antibody
PA1694 100ug/vial
EUR 294
Human SSTR2 ELISA Kit
ELA-E2292h 96 Tests
EUR 824
SSTR2 ELISA KIT|Human
EF006273 96 Tests
EUR 689
Mouse SSTR2 shRNA Plasmid
20-abx972787
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SSTR2 shRNA Plasmid
20-abx985832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SSTR2 shRNA Plasmid
20-abx954615
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Somatostatin Receptor-2-SSTR2
MO15109 100 ug
EUR 409
Somatostatin Receptor-2-SSTR2
RA25005 100 ul
EUR 383
SSTr2 Recombinant Protein (Rat)
RP231206 100 ug Ask for price
pCMV-SPORT6-SSTR2 Plasmid
PVT16171 2 ug
EUR 325
SSTr2 Recombinant Protein (Human)
RP030184 100 ug Ask for price
SSTr2 Recombinant Protein (Mouse)
RP175664 100 ug Ask for price
SSTr2 Recombinant Protein (Mouse)
RP175667 100 ug Ask for price
Somatostatin Receptor Type 2 (SSTR2) Antibody (HRP)
20-abx313112
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Somatostatin Receptor Type 2 (SSTR2) Antibody (FITC)
20-abx313113
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Somatostatin Receptor Type 2 (SSTR2) Antibody (Biotin)
20-abx313114
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sstr2 ORF Vector (Rat) (pORF)
ORF077070 1.0 ug DNA
EUR 506
SSTR2 ORF Vector (Human) (pORF)
ORF010062 1.0 ug DNA
EUR 95
Sstr2 ORF Vector (Mouse) (pORF)
ORF058556 1.0 ug DNA
EUR 506
Sstr2 ORF Vector (Mouse) (pORF)
ORF058557 1.0 ug DNA
EUR 506
Recombinant Somatostatin Receptor 2 (SSTR2)
4-RPG032Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Somatostatin Receptor 2 expressed in: E.coli
SSTR2 ELISA Kit (Mouse) (OKEH05177)
OKEH05177 96 Wells
EUR 662
Description: Description of target: Receptor for somatostatin-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and PLC via pertussis toxin insensitive as well as sensitive G proteins. Inhibits calcium entry by suppressing voltage-dependent calcium channels. Acts as the functionally dominant somatostatin receptor in pancreatic alpha- and beta-cells where it mediates the inhibitory effect of somatostatin-14 on hormone secretion. Inhibits cell growth through enhancement of MAPK1 and MAPK2 phosphorylation and subsequent up-regulation of CDKN1B. Stimulates neuronal migration and axon outgrowth and may participate in neuron development and maturation during brain development. Mediates negative regulation of insulin receptor signaling through PTPN6. Inactivates SSTR3 receptor function following heterodimerization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL
SSTR2 ELISA Kit (Rat) (OKEH06024)
OKEH06024 96 Wells
EUR 662
Description: Description of target: Receptor for somatostatin-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and PLC via pertussis toxin insensitive as well as sensitive G proteins. Inhibits calcium entry by suppressing voltage-dependent calcium channels. Acts as the functionally dominant somatostatin receptor in pancreatic alpha- and beta-cells where it mediates the inhibitory effect of somatostatin-14 on hormone secretion. Inhibits cell growth through enhancement of MAPK1 and MAPK2 phosphorylation and subsequent up-regulation of CDKN1B. Stimulates neuronal migration and axon outgrowth and may participate in neuron development and maturation during brain development. Mediates negative regulation of insulin receptor signaling through PTPN6. Inactivates SSTR3 receptor function following heterodimerization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL
Human Somatostatin Receptor 2 (SSTR2) Protein
20-abx652236
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Sstr2 sgRNA CRISPR Lentivector set (Rat)
K6874201 3 x 1.0 ug
EUR 339
Sstr2 sgRNA CRISPR Lentivector set (Mouse)
K3395601 3 x 1.0 ug
EUR 339
SSTR2 sgRNA CRISPR Lentivector set (Human)
K2291101 3 x 1.0 ug
EUR 339
Human Somatostatin Receptor 2 (SSTR2) ELISA Kit
abx352051-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Sstr2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6874202 1.0 ug DNA
EUR 154
Sstr2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6874203 1.0 ug DNA
EUR 154
Sstr2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6874204 1.0 ug DNA
EUR 154
Sstr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3395602 1.0 ug DNA
EUR 154
Sstr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3395603 1.0 ug DNA
EUR 154
Sstr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3395604 1.0 ug DNA
EUR 154
SSTR2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2291102 1.0 ug DNA
EUR 154
SSTR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2291103 1.0 ug DNA
EUR 154
SSTR2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2291104 1.0 ug DNA
EUR 154
SSTr2 Protein Vector (Rat) (pPB-C-His)
PV308278 500 ng
EUR 603
SSTr2 Protein Vector (Rat) (pPB-N-His)
PV308279 500 ng
EUR 603
SSTr2 Protein Vector (Rat) (pPM-C-HA)
PV308280 500 ng
EUR 603
SSTr2 Protein Vector (Rat) (pPM-C-His)
PV308281 500 ng
EUR 603
SSTr2 Protein Vector (Human) (pPB-C-His)
PV040245 500 ng
EUR 329
SSTr2 Protein Vector (Human) (pPB-N-His)
PV040246 500 ng
EUR 329
SSTr2 Protein Vector (Human) (pPM-C-HA)
PV040247 500 ng
EUR 329