Order Now: brent@sdlifesciences.com
SPOP Polyclonal Antibody |
ABP57529-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90 |
SPOP Polyclonal Antibody |
ABP57529-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90 |
SPOP Polyclonal Antibody |
ABP57529-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
- Applications tips:
|
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90 |
SPOP Polyclonal Antibody |
ES8522-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SPOP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
SPOP Polyclonal Antibody |
ES8522-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SPOP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
SPOP Rabbit pAb |
A12106-100ul |
Abclonal |
100 ul |
EUR 308 |
SPOP Rabbit pAb |
A12106-200ul |
Abclonal |
200 ul |
EUR 459 |
SPOP Rabbit pAb |
A12106-20ul |
Abclonal |
20 ul |
EUR 183 |
SPOP Rabbit pAb |
A12106-50ul |
Abclonal |
50 ul |
EUR 223 |
SPOP Rabbit pAb |
A7621-100ul |
Abclonal |
100 ul |
EUR 308 |
SPOP Rabbit pAb |
A7621-200ul |
Abclonal |
200 ul |
EUR 459 |
SPOP Rabbit pAb |
A7621-20ul |
Abclonal |
20 ul |
EUR 183 |
SPOP Rabbit pAb |
A7621-50ul |
Abclonal |
50 ul |
EUR 223 |
SPOP Polyclonal Conjugated Antibody |
C46746 |
SAB |
100ul |
EUR 397 |
SPOP Antibody |
DF12106 |
Affbiotech |
200ul |
EUR 304 |
Description: SPOP antibody detects endogenous levels of SPOP. |
SPOP antibody |
70R-8876 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SPOP antibody |
SPOP Antibody |
1-CSB-PA022601LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Rabbit SPOP ELISA Kit |
ERTS0183 |
Abclonal |
96Tests |
EUR 521 |
SPOP Polyclonal Antibody, Biotin Conjugated |
A61131 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
SPOP Polyclonal Antibody, FITC Conjugated |
A61132 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SPOP Polyclonal Antibody, HRP Conjugated |
A61133 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Anti-SPOP Antibody |
A02032 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for SPOP Antibody (SPOP) detection.tested for IHC, WB in Human, Mouse, Rat. |
anti- SPOP antibody |
FNab08189 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:500
- IP : 1:500-1:1000
- Immunogen: speckle-type POZ protein
- Uniprot ID: O43791
- Gene ID: 8405
- Research Area: Metabolism
|
Description: Antibody raised against SPOP |
Anti-SPOP antibody |
STJ114000 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. |
Anti-SPOP antibody |
STJ29758 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. |
Anti-SPOP antibody |
STJ98635 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to SPOP. |
SPOP siRNA |
20-abx935022 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPOP siRNA |
20-abx935023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SPOP |
YF-PA15616 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SPOP |
anti-SPOP |
YF-PA15617 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to SPOP |
SPOP Antibody, HRP conjugated |
1-CSB-PA022601LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SPOP Antibody, FITC conjugated |
1-CSB-PA022601LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SPOP Antibody, Biotin conjugated |
1-CSB-PA022601LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SPOP Blocking Peptide |
33R-10118 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPOP antibody, catalog no. 70R-8876 |
SPOP Blocking Peptide |
DF12106-BP |
Affbiotech |
1mg |
EUR 195 |
SPOP cloning plasmid |
CSB-CL022601HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1125
- Sequence: atgtcaagggttccaagtcctccacctccggcagaaatgtcgagtggccccgtagctgagagttggtgctacacacagatcaaggtagtgaaattctcctacatgtggaccatcaataactttagcttttgccgggaggaaatgggtgaagtcattaaaagttctacattttcat
- Show more
|
Description: A cloning plasmid for the SPOP gene. |
Anti-SPOP (3E2) |
YF-MA16346 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SPOP |
Rabbit Speckle Type POZ Protein (SPOP) ELISA Kit |
abx362370-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Speckle Type POZ Protein (SPOP) Antibody |
20-abx123223 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Speckle Type POZ Protein (SPOP) Antibody |
20-abx126631 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Speckle Type POZ Protein (SPOP) Antibody |
abx238189-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Speckle Type POZ Protein (SPOP) Antibody |
20-abx301288 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
SPOP protein (His tag) |
80R-1767 |
Fitzgerald |
50 ug |
EUR 397 |
Description: Purified recombinant Human SPOP protein |
Human SPOP ELISA Kit |
EHS0183 |
Abclonal |
96Tests |
EUR 521 |
Bovine SPOP ELISA Kit |
EBS0183 |
Abclonal |
96Tests |
EUR 521 |
Anserine SPOP ELISA Kit |
EAS0183 |
Abclonal |
96Tests |
EUR 521 |
Canine SPOP ELISA Kit |
ECS0183 |
Abclonal |
96Tests |
EUR 521 |
Goat SPOP ELISA Kit |
EGTS0183 |
Abclonal |
96Tests |
EUR 521 |
Mouse SPOP shRNA Plasmid |
20-abx972869 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SPOP shRNA Plasmid |
20-abx955508 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine SPOP ELISA Kit |
EPS0183 |
Abclonal |
96Tests |
EUR 521 |
Rat SPOP ELISA Kit |
ERS0183 |
Abclonal |
96Tests |
EUR 521 |
Mouse SPOP ELISA Kit |
EMS0183 |
Abclonal |
96Tests |
EUR 521 |
Speckle Type POZ Protein (SPOP) Antibody (HRP) |
20-abx305411 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Speckle Type POZ Protein (SPOP) Antibody (FITC) |
20-abx305412 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Speckle Type POZ Protein (SPOP) Antibody (Biotin) |
20-abx305413 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Guinea Pig SPOP ELISA Kit |
EGS0183 |
Abclonal |
96Tests |
EUR 521 |
Spop ORF Vector (Rat) (pORF) |
ORF076963 |
ABM |
1.0 ug DNA |
EUR 506 |
SPOP ORF Vector (Human) (pORF) |
ORF009989 |
ABM |
1.0 ug DNA |
EUR 95 |
Spop ORF Vector (Mouse) (pORF) |
ORF058398 |
ABM |
1.0 ug DNA |
EUR 506 |
SPOP ELISA Kit (Human) (OKEI00190) |
OKEI00190 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Component of a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex that mediates the ubiquitination of target proteins, leading most often to their proteasomal degradation. In complex with CUL3, involved in ubiquitination and proteasomal degradation of BRMS1, DAXX, PDX1/IPF1, GLI2 and GLI3. In complex with CUL3, involved in ubiquitination of H2AFY and BMI1; this does not lead to their proteasomal degradation. Inhibits transcriptional activation of PDX1/IPF1 targets, such as insulin, by promoting PDX1/IPF1 degradation. The cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOP has higher ubiquitin ligase activity than the complex that contains the heterodimer formed by SPOP and SPOPL.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL |
SPOP ELISA Kit (Mouse) (OKEI00554) |
OKEI00554 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Component of a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex that mediates the ubiquitination of target proteins, leading most often to their proteasomal degradation. The cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOP has higher ubiquitin ligase activity than the complex that contains the heterodimer formed by SPOP and SPOPL.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Speckle Type POZ Protein (SPOP) Protein |
20-abx262763 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Spop sgRNA CRISPR Lentivector set (Rat) |
K6617601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spop sgRNA CRISPR Lentivector set (Mouse) |
K3411401 |
ABM |
3 x 1.0 ug |
EUR 339 |
SPOP sgRNA CRISPR Lentivector set (Human) |
K2278501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spop sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6617602 |
ABM |
1.0 ug DNA |
EUR 154 |
Spop sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6617603 |
ABM |
1.0 ug DNA |
EUR 154 |
Spop sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6617604 |
ABM |
1.0 ug DNA |
EUR 154 |
Spop sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3411402 |
ABM |
1.0 ug DNA |
EUR 154 |
Spop sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3411403 |
ABM |
1.0 ug DNA |
EUR 154 |
Spop sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3411404 |
ABM |
1.0 ug DNA |
EUR 154 |
SPOP sgRNA CRISPR Lentivector (Human) (Target 1) |
K2278502 |
ABM |
1.0 ug DNA |
EUR 154 |
SPOP sgRNA CRISPR Lentivector (Human) (Target 2) |
K2278503 |
ABM |
1.0 ug DNA |
EUR 154 |
SPOP sgRNA CRISPR Lentivector (Human) (Target 3) |
K2278504 |
ABM |
1.0 ug DNA |
EUR 154 |
SPOP Protein Vector (Rat) (pPB-C-His) |
PV307850 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Rat) (pPB-N-His) |
PV307851 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Rat) (pPM-C-HA) |
PV307852 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Rat) (pPM-C-His) |
PV307853 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Human) (pPB-C-His) |
PV039953 |
ABM |
500 ng |
EUR 329 |
SPOP Protein Vector (Human) (pPB-N-His) |
PV039954 |
ABM |
500 ng |
EUR 329 |
SPOP Protein Vector (Human) (pPM-C-HA) |
PV039955 |
ABM |
500 ng |
EUR 329 |
SPOP Protein Vector (Human) (pPM-C-His) |
PV039956 |
ABM |
500 ng |
EUR 329 |
SPOP Protein Vector (Mouse) (pPB-C-His) |
PV233590 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Mouse) (pPB-N-His) |
PV233591 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Mouse) (pPM-C-HA) |
PV233592 |
ABM |
500 ng |
EUR 603 |
SPOP Protein Vector (Mouse) (pPM-C-His) |
PV233593 |
ABM |
500 ng |
EUR 603 |
Recombinant Human SPOP Protein, His, E.coli-10ug |
QP13579-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human SPOP Protein, His, E.coli-1mg |
QP13579-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human SPOP Protein, His, E.coli-2ug |
QP13579-2ug |
EnQuireBio |
2ug |
EUR 155 |
Spop 3'UTR Luciferase Stable Cell Line |
TU119625 |
ABM |
1.0 ml |
Ask for price |
Spop 3'UTR GFP Stable Cell Line |
TU169625 |
ABM |
1.0 ml |
Ask for price |
Spop 3'UTR Luciferase Stable Cell Line |
TU221112 |
ABM |
1.0 ml |
Ask for price |
SPOP 3'UTR GFP Stable Cell Line |
TU074520 |
ABM |
1.0 ml |
EUR 1394 |
Spop 3'UTR GFP Stable Cell Line |
TU271112 |
ABM |
1.0 ml |
Ask for price |
SPOP 3'UTR Luciferase Stable Cell Line |
TU024520 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |