SCAMP1 Rabbit Polyclonal Antibody

Order Now:

SCAMP1 Polyclonal Antibody
ES8050-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SCAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SCAMP1 Polyclonal Antibody
ABP57051-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
SCAMP1 Polyclonal Antibody
ABP57051-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
SCAMP1 Polyclonal Antibody
ABP57051-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
SCAMP1 Polyclonal Antibody
A68703 100 ?g
EUR 628.55
Description: Ask the seller for details
SCAMP1 Rabbit pAb
A9092-100ul 100 ul
EUR 308
SCAMP1 Rabbit pAb
A9092-200ul 200 ul
EUR 459
SCAMP1 Rabbit pAb
A9092-20ul 20 ul
EUR 183
SCAMP1 Rabbit pAb
A9092-50ul 50 ul
EUR 223
SCAMP1 antibody
70R-50718 100 ul
EUR 244
Description: Purified Polyclonal SCAMP1 antibody
SCAMP1 antibody
70R-9783 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SCAMP1 antibody
Scamp1 antibody
70R-9784 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Scamp1 antibody
SCAMP1 Antibody
ABD4453 100 ug
EUR 438
SCAMP1 Antibody
47872-100ul 100ul
EUR 252
SCAMP1 antibody
70R-20095 50 ul
EUR 435
Description: Rabbit polyclonal SCAMP1 antibody
SCAMP1 Antibody
DF4453 200ul
EUR 304
Description: SCAMP1 Antibody detects endogenous levels of total SCAMP1.
SCAMP1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
SCAMP1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SCAMP1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500
SCAMP1 Polyclonal Antibody, HRP Conjugated
A68704 100 ?g
EUR 628.55
Description: The best epigenetics products
SCAMP1 Polyclonal Antibody, FITC Conjugated
A68705 100 ?g
EUR 628.55
Description: kits suitable for this type of research
SCAMP1 Polyclonal Antibody, Biotin Conjugated
A68706 100 ?g
EUR 628.55
Description: fast delivery possible
Polyclonal Scamp1 antibody - N-terminal region
APR13201G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Scamp1 - N-terminal region. This antibody is tested and proven to work in the following applications:
SCAMP1 Conjugated Antibody
C47872 100ul
EUR 397
anti- SCAMP1 antibody
FNab07620 100µg
EUR 548.75
  • Immunogen: secretory carrier membrane protein 1
  • Uniprot ID: O15126
  • Gene ID: 9522
  • Research Area: Signal Transduction, Neuroscience
Description: Antibody raised against SCAMP1
Anti-SCAMP1 Antibody
A08692 100ul
EUR 397
Description: Rabbit Polyclonal SCAMP1 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-SCAMP1 antibody
PAab07620 100 ug
EUR 386
Anti-SCAMP1 antibody
STJ95583 200 µl
EUR 197
Description: Rabbit polyclonal to SCAMP1.
Anti-SCAMP1 antibody
STJ111561 100 µl
EUR 277
Description: This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants.
Anti-SCAMP1 antibody
STJ13100375 100 µl
EUR 427
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCAMP1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SCAMP1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SCAMP1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SCAMP1 cloning plasmid
CSB-CL020750HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaata
  • Show more
Description: A cloning plasmid for the SCAMP1 gene.
SCAMP1 cloning plasmid
CSB-CL020750HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 474
  • Sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatac
  • Show more
Description: A cloning plasmid for the SCAMP1 gene.
SCAMP1 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Scamp1 Blocking Peptide
33R-3594 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Scamp1 antibody, catalog no. 70R-9784
SCAMP1 Blocking Peptide
33R-4861 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCAMP1 antibody, catalog no. 70R-9783
SCAMP1 Blocking Peptide
DF4453-BP 1mg
EUR 195
pBluescriptR-SCAMP1 Plasmid
PVT15860 2 ug
EUR 325
Mouse SCAMP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SCAMP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELA-E9859h 96 Tests
EUR 824
EF006553 96 Tests
EUR 689
Human SCAMP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SCAMP1 Recombinant Protein (Human)
RP027649 100 ug Ask for price
SCAMP1 Recombinant Protein (Human)
RP027652 100 ug Ask for price
SCAMP1 Recombinant Protein (Rat)
RP227552 100 ug Ask for price
SCAMP1 Recombinant Protein (Mouse)
RP170117 100 ug Ask for price
Secretory Carrier Membrane Protein 1 (SCAMP1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
SCAMP1 ORF Vector (Human) (pORF)
ORF009217 1.0 ug DNA
EUR 95
SCAMP1 ORF Vector (Human) (pORF)
ORF009218 1.0 ug DNA
EUR 95
Scamp1 ORF Vector (Mouse) (pORF)
ORF056707 1.0 ug DNA
EUR 506
Scamp1 ORF Vector (Rat) (pORF)
ORF075852 1.0 ug DNA
EUR 506
SCAMP1 ELISA Kit (Human) (OKEH02023)
OKEH02023 96 Wells
EUR 727
Description: Description of target: This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 36 pg/mL
SCAMP1 ELISA Kit (Mouse) (OKEH04952)
OKEH04952 96 Wells
EUR 727
Description: Description of target: Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL
SCAMP1 ELISA Kit (Rat) (OKEH05933)
OKEH05933 96 Wells
EUR 727
Description: Description of target: Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody
abx237620-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SCAMP1 sgRNA CRISPR Lentivector set (Human)
K2093801 3 x 1.0 ug
EUR 339
Scamp1 sgRNA CRISPR Lentivector set (Mouse)
K3044101 3 x 1.0 ug
EUR 339
Scamp1 sgRNA CRISPR Lentivector set (Rat)
K6925801 3 x 1.0 ug
EUR 339
Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.