Order Now: brent@sdlifesciences.com
SCAMP1 Polyclonal Antibody |
ABP57051-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
- Applications tips:
|
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330 |
SCAMP1 Polyclonal Antibody |
ABP57051-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
- Applications tips:
|
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330 |
SCAMP1 Polyclonal Antibody |
ABP57051-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330
- Applications tips:
|
Description: A polyclonal antibody for detection of SCAMP1 from Human, Mouse, Rat. This SCAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SCAMP1 at AA range: 250-330 |
SCAMP1 Polyclonal Antibody |
ES8050-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SCAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SCAMP1 Polyclonal Antibody |
ES8050-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SCAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SCAMP1 Rabbit pAb |
A9092-100ul |
Abclonal |
100 ul |
EUR 308 |
SCAMP1 Rabbit pAb |
A9092-200ul |
Abclonal |
200 ul |
EUR 459 |
SCAMP1 Rabbit pAb |
A9092-20ul |
Abclonal |
20 ul |
EUR 183 |
SCAMP1 Rabbit pAb |
A9092-50ul |
Abclonal |
50 ul |
EUR 223 |
SCAMP1 antibody |
70R-20095 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SCAMP1 antibody |
SCAMP1 Antibody |
47872-100ul |
SAB |
100ul |
EUR 252 |
SCAMP1 Antibody |
1-CSB-PA080014 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
SCAMP1 Antibody |
DF4453 |
Affbiotech |
200ul |
EUR 304 |
Description: SCAMP1 Antibody detects endogenous levels of total SCAMP1. |
SCAMP1 antibody |
70R-9783 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SCAMP1 antibody |
Scamp1 antibody |
70R-9784 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Scamp1 antibody |
SCAMP1 antibody |
70R-50718 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal SCAMP1 antibody |
SCAMP1 Antibody |
1-CSB-PA020750GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
SCAMP1 Antibody |
1-CSB-PA020750LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500 |
SCAMP1 Polyclonal Antibody, HRP Conjugated |
A68704 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
SCAMP1 Polyclonal Antibody, FITC Conjugated |
A68705 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
SCAMP1 Polyclonal Antibody, Biotin Conjugated |
A68706 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
Polyclonal Scamp1 antibody - N-terminal region |
APR13201G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Scamp1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-SCAMP1 Antibody |
A08692 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal SCAMP1 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
SCAMP1 Conjugated Antibody |
C47872 |
SAB |
100ul |
EUR 397 |
anti- SCAMP1 antibody |
FNab07620 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: secretory carrier membrane protein 1
- Uniprot ID: O15126
- Gene ID: 9522
- Research Area: Signal Transduction, Neuroscience
|
Description: Antibody raised against SCAMP1 |
Anti-SCAMP1 antibody |
STJ111561 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. |
Anti-SCAMP1 antibody |
STJ95583 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to SCAMP1. |
SCAMP1 siRNA |
20-abx904784 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCAMP1 siRNA |
20-abx932528 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCAMP1 siRNA |
20-abx932529 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCAMP1 Antibody, HRP conjugated |
1-CSB-PA020750LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SCAMP1 Antibody, FITC conjugated |
1-CSB-PA020750LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SCAMP1 Antibody, Biotin conjugated |
1-CSB-PA020750LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCAMP1. Recognizes SCAMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Scamp1 Blocking Peptide |
33R-3594 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Scamp1 antibody, catalog no. 70R-9784 |
SCAMP1 Blocking Peptide |
33R-4861 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCAMP1 antibody, catalog no. 70R-9783 |
SCAMP1 Blocking Peptide |
DF4453-BP |
Affbiotech |
1mg |
EUR 195 |
SCAMP1 Blocking Peptide |
20-abx063593 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCAMP1 cloning plasmid |
CSB-CL020750HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1017
- Sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaata
- Show more
|
Description: A cloning plasmid for the SCAMP1 gene. |
SCAMP1 cloning plasmid |
CSB-CL020750HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 474
- Sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatac
- Show more
|
Description: A cloning plasmid for the SCAMP1 gene. |
Rat SCAMP1 shRNA Plasmid |
20-abx985558 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SCAMP1 shRNA Plasmid |
20-abx956328 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SCAMP1 shRNA Plasmid |
20-abx979838 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SCAMP1 Recombinant Protein (Human) |
RP027649 |
ABM |
100 ug |
Ask for price |
SCAMP1 Recombinant Protein (Human) |
RP027652 |
ABM |
100 ug |
Ask for price |
SCAMP1 Recombinant Protein (Rat) |
RP227552 |
ABM |
100 ug |
Ask for price |
SCAMP1 Recombinant Protein (Mouse) |
RP170117 |
ABM |
100 ug |
Ask for price |
Secretory Carrier Membrane Protein 1 (SCAMP1) Antibody |
20-abx115415 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Scamp1 ORF Vector (Rat) (pORF) |
ORF075852 |
ABM |
1.0 ug DNA |
EUR 506 |
SCAMP1 ORF Vector (Human) (pORF) |
ORF009217 |
ABM |
1.0 ug DNA |
EUR 95 |
SCAMP1 ORF Vector (Human) (pORF) |
ORF009218 |
ABM |
1.0 ug DNA |
EUR 95 |
Scamp1 ORF Vector (Mouse) (pORF) |
ORF056707 |
ABM |
1.0 ug DNA |
EUR 506 |
SCAMP1 ELISA Kit (Rat) (OKEH05933) |
OKEH05933 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL |
SCAMP1 ELISA Kit (Mouse) (OKEH04952) |
OKEH04952 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Functions in post-Golgi recycling pathways. Acts as a recycling carrier to the cell surface.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL |
SCAMP1 ELISA Kit (Human) (OKEH02023) |
OKEH02023 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 36 pg/mL |
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody |
20-abx008413 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody |
20-abx119131 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody |
20-abx123684 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Secretory Carrier-Associated Membrane Protein 1 (SCAMP1) Antibody |
abx237620-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody |
20-abx338696 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody |
20-abx327476 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Scamp1 sgRNA CRISPR Lentivector set (Rat) |
K6925801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Scamp1 sgRNA CRISPR Lentivector set (Mouse) |
K3044101 |
ABM |
3 x 1.0 ug |
EUR 339 |
SCAMP1 sgRNA CRISPR Lentivector set (Human) |
K2093801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Secretory carrier-associated membrane protein 1 (SCAMP1) Antibody (HRP) |
20-abx337567 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|