Order Now: brent@sdlifesciences.com
Polyclonal RHEB Antibody |
AMR09741G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RHEB . This antibody is tested and proven to work in the following applications: |
RHEB Polyclonal Antibody |
ABP57482-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide of RHEB
- Applications tips:
|
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB |
RHEB Polyclonal Antibody |
ABP57482-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide of RHEB
- Applications tips:
|
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB |
RHEB Polyclonal Antibody |
ABP57482-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide of RHEB
- Applications tips:
|
Description: A polyclonal antibody for detection of RHEB from Human, Mouse, Rat, Cow. This RHEB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of RHEB |
RHEB Polyclonal Antibody |
ES8475-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RHEB from Human/Mouse/Rat/Cow. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RHEB Polyclonal Antibody |
ES8475-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RHEB from Human/Mouse/Rat/Cow. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RHEB Rabbit pAb |
A1165-100ul |
Abclonal |
100 ul |
EUR 308 |
RHEB Rabbit pAb |
A1165-200ul |
Abclonal |
200 ul |
EUR 459 |
RHEB Rabbit pAb |
A1165-20ul |
Abclonal |
20 ul |
EUR 183 |
RHEB Rabbit pAb |
A1165-50ul |
Abclonal |
50 ul |
EUR 223 |
RHEB Rabbit mAb |
A3702-100ul |
Abclonal |
100 ul |
EUR 410 |
RHEB Rabbit mAb |
A3702-200ul |
Abclonal |
200 ul |
EUR 571 |
RHEB Rabbit mAb |
A3702-20ul |
Abclonal |
20 ul |
EUR 221 |
RHEB Rabbit mAb |
A3702-50ul |
Abclonal |
50 ul |
EUR 287 |
Rheb Antibody |
24306-100ul |
SAB |
100ul |
EUR 390 |
Rheb Antibody |
24307-100ul |
SAB |
100ul |
EUR 390 |
RHEB antibody |
70R-19883 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RHEB antibody |
RHEB Antibody |
32196-100ul |
SAB |
100ul |
EUR 252 |
RHEB Antibody |
49914-100ul |
SAB |
100ul |
EUR 333 |
RHEB Antibody |
49914-50ul |
SAB |
50ul |
EUR 239 |
RHEB Antibody |
42737-100ul |
SAB |
100ul |
EUR 252 |
RHEB Antibody |
1-CSB-PA072418 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
RHEB Antibody |
1-CSB-PA077173 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50 |
RHEB Antibody |
1-CSB-PA088225 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
RHEB Antibody |
1-CSB-PA124825 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
RHEB Antibody |
1-CSB-PA624022LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
RHEB Antibody |
DF6299 |
Affbiotech |
200ul |
EUR 304 |
Description: RHEB Antibody detects endogenous levels of total RHEB. |
RHEB Antibody |
1-CSB-PA442874 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
RHEB Antibody |
1-CSB-PA256263 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
RHEB antibody |
70R-5794 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RHEB antibody raised against the middle region of RHEB |
RHEB Antibody |
1-CSB-PA019678GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal RHEB Antibody (C-term) |
AMR09752G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RHEB (C-term). This antibody is tested and proven to work in the following applications: |
Human Rheb Antibody |
32694-05111 |
AssayPro |
150 ug |
EUR 261 |
RHEB Conjugated Antibody |
C49914 |
SAB |
100ul |
EUR 397 |
RHEB Conjugated Antibody |
C32196 |
SAB |
100ul |
EUR 397 |
anti- RHEB antibody |
FNab07280 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Ras homolog enriched in brain
- Uniprot ID: Q15382
- Gene ID: 6009
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against RHEB |
Anti-RHEB antibody |
STJ25350 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. This protein is vital in regulation of growth and cell cycle progression due to its role in the insulin/TOR/S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of the protein is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22. |
Anti-RHEB antibody |
STJ98588 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: RHEB is a protein encoded by the RHEB gene which is approximately 20,5 kDa. RHEB is localised to the cytoplasm, Golgi apparatus membrane, cytosol and endoplasmic reticulum membrane. It is involved in the regulation of lipid metabolism, insulin signalling-generic cascades, mTOR signalling, RET signalling, AMP-activated protein kinase signalling and the phospholipase D signalling pathway. The RHEB gene is a member of the small GTPase superfamily and encodes the lipid-anchored, cell membrane protein, RHEB. This protein is vital in regulation of growth and cell cycle progression. RHEB is ubiquitous expressed with highest levels observed in skeletal and cardiac muscle. Mutations in the RHEB can result in tuberous sclerosis. STJ98588 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody binds to endogenous levels of RHEB. |
RHEB siRNA |
20-abx904568 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RHEB siRNA |
20-abx931459 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RHEB siRNA |
20-abx931460 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RHEB |
YF-PA14387 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RHEB |
anti-RHEB |
YF-PA14388 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RHEB |
anti-RHEB |
YF-PA14389 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to RHEB |
anti-RHEB |
YF-PA14390 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to RHEB |
RHEB Antibody, HRP conjugated |
1-CSB-PA624022LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RHEB Antibody, FITC conjugated |
1-CSB-PA624022LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RHEB Antibody, Biotin conjugated |
1-CSB-PA624022LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHEB. Recognizes RHEB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse GTP- binding protein Rheb, Rheb ELISA KIT |
ELI-19245m |
Lifescience Market |
96 Tests |
EUR 865 |
Human GTP- binding protein Rheb, RHEB ELISA KIT |
ELI-30320h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine GTP- binding protein Rheb, RHEB ELISA KIT |
ELI-52257b |
Lifescience Market |
96 Tests |
EUR 928 |
RHEB Blocking Peptide |
33R-9564 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHEB antibody, catalog no. 70R-5794 |
RHEB Blocking Peptide |
DF6299-BP |
Affbiotech |
1mg |
EUR 195 |
RHEB cloning plasmid |
CSB-CL624022HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 555
- Sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgt
- Show more
|
Description: A cloning plasmid for the RHEB gene. |
RHEB cloning plasmid |
CSB-CL624022HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 555
- Sequence: atgccgcagtccaagtcccggaagatcgcgatcctgggctaccggtctgtggggaaatcctcattgacgattcaatttgttgaaggccaatttgtggactcctacgatccaaccatagaaaacacttttacaaagttgatcacagtaaatggacaagaatatcatcttcaacttgt
- Show more
|
Description: A cloning plasmid for the RHEB gene. |
Recombinant Human Rheb |
P0391 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: Q15382
|
Description: Recombinant Human protein for Rheb |
Anti-RHEB (2C11) |
YF-MA10784 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RHEB |
Anti-RHEB (1E12) |
YF-MA15193 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RHEB |
Human Rheb Antibody (Biotin Conjugate) |
32694-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal Rheb Antibody, Clone: EPR2971 |
AMR09740G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human Rheb. The antibodies are raised in Rabbit and are from clone EPR2971. This antibody is applicable in WB and IHC |
Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST) |
CG22-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0. |
Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST) |
CG22-1mg |
Novoprotein |
1mg |
EUR 2486 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0. |
Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST) |
CG22-500ug |
Novoprotein |
500ug |
EUR 1755 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0. |
Recombinant Human GTP-Binding Protein Rheb/RHEB (N-GST) |
CG22-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 10mM GSH, pH 8.0. |
Human Rheb AssayLite Antibody (FITC Conjugate) |
32694-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Rheb AssayLite Antibody (RPE Conjugate) |
32694-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Rheb AssayLite Antibody (APC Conjugate) |
32694-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Rheb AssayLite Antibody (PerCP Conjugate) |
32694-05171 |
AssayPro |
150 ug |
EUR 471 |
RheB protein (T7 tag) |
80R-1076 |
Fitzgerald |
100 ug |
EUR 224 |
Description: Purified recombinant Human RheB protein (T7 tag) |
Mouse RHEB shRNA Plasmid |
20-abx972457 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RHEB shRNA Plasmid |
20-abx985288 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RHEB shRNA Plasmid |
20-abx954076 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RHEB Recombinant Protein (Human) |
RP026371 |
ABM |
100 ug |
Ask for price |
RHEB Recombinant Protein (Human) |
RP026374 |
ABM |
100 ug |
Ask for price |
RHEB Recombinant Protein (Mouse) |
RP167990 |
ABM |
100 ug |
Ask for price |
RHEB Recombinant Protein (Rat) |
RP226019 |
ABM |
100 ug |
Ask for price |
Ras Homolog Enriched In Brain (RHEB) Antibody |
abx026430-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
abx026430-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx214387 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx214959 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx214960 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx213656 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx213657 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx115059 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
abx145070-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx142196 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx242233 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
abx237280-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx313390 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody |
20-abx001079 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rheb ORF Vector (Rat) (pORF) |
ORF075341 |
ABM |
1.0 ug DNA |
EUR 506 |
RHEB ORF Vector (Human) (pORF) |
ORF008791 |
ABM |
1.0 ug DNA |
EUR 95 |
RHEB ORF Vector (Human) (pORF) |
ORF008792 |
ABM |
1.0 ug DNA |
EUR 95 |
Rheb ORF Vector (Mouse) (pORF) |
ORF055998 |
ABM |
1.0 ug DNA |
EUR 506 |
Ras Homolog Enriched In Brain (RHEB) Antibody (HRP) |
20-abx313391 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody (FITC) |
20-abx313392 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ras Homolog Enriched In Brain (RHEB) Antibody (Biotin) |
20-abx313393 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rheb sgRNA CRISPR Lentivector set (Rat) |
K6822501 |
ABM |
3 x 1.0 ug |
EUR 339 |
RHEB sgRNA CRISPR Lentivector set (Human) |
K1820301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rheb sgRNA CRISPR Lentivector set (Mouse) |
K4604901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ras Homolog Enriched In Brain (RHEB) Protein |
20-abx260430 |
Abbexa |
-
EUR 230.00
-
EUR 2332.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
Rheb sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6822502 |
ABM |
1.0 ug DNA |
EUR 154 |
Rheb sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6822503 |
ABM |
1.0 ug DNA |
EUR 154 |
Rheb sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6822504 |
ABM |
1.0 ug DNA |
EUR 154 |
RHEB sgRNA CRISPR Lentivector (Human) (Target 1) |
K1820302 |
ABM |
1.0 ug DNA |
EUR 154 |
RHEB sgRNA CRISPR Lentivector (Human) (Target 2) |
K1820303 |
ABM |
1.0 ug DNA |
EUR 154 |
RHEB sgRNA CRISPR Lentivector (Human) (Target 3) |
K1820304 |
ABM |
1.0 ug DNA |
EUR 154 |
Rheb sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4604902 |
ABM |
1.0 ug DNA |
EUR 154 |
Rheb sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4604903 |
ABM |
1.0 ug DNA |
EUR 154 |
Rheb sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4604904 |
ABM |
1.0 ug DNA |
EUR 154 |
RHEB Protein Vector (Rat) (pPB-C-His) |
PV301362 |
ABM |
500 ng |
EUR 603 |
RHEB Protein Vector (Rat) (pPB-N-His) |
PV301363 |
ABM |
500 ng |
EUR 603 |
RHEB Protein Vector (Rat) (pPM-C-HA) |
PV301364 |
ABM |
500 ng |
EUR 603 |
RHEB Protein Vector (Rat) (pPM-C-His) |
PV301365 |
ABM |
500 ng |
EUR 603 |
RHEB Protein Vector (Human) (pPB-C-His) |
PV035161 |
ABM |
500 ng |
EUR 329 |
RHEB Protein Vector (Human) (pPB-N-His) |
PV035162 |
ABM |
500 ng |
EUR 329 |
RHEB Protein Vector (Human) (pPM-C-HA) |
PV035163 |
ABM |
500 ng |
EUR 329 |
RHEB Protein Vector (Human) (pPM-C-His) |
PV035164 |
ABM |
500 ng |
EUR 329 |
RHEB Protein Vector (Human) (pPB-C-His) |
PV035165 |
ABM |
500 ng |
EUR 329 |
RHEB Protein Vector (Human) (pPB-N-His) |
PV035166 |
ABM |
500 ng |
EUR 329 |