Order Now: brent@sdlifesciences.com
RASSF2 Polyclonal Antibody |
ABP57099-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160 |
RASSF2 Polyclonal Antibody |
29412-100ul |
SAB |
100ul |
EUR 252 |
RASSF2 Polyclonal Antibody |
29412-50ul |
SAB |
50ul |
EUR 187 |
RASSF2 Polyclonal Antibody |
29413-100ul |
SAB |
100ul |
EUR 252 |
RASSF2 Polyclonal Antibody |
29413-50ul |
SAB |
50ul |
EUR 187 |
RASSF2 Rabbit pAb |
A15766-100ul |
Abclonal |
100 ul |
EUR 308 |
RASSF2 Rabbit pAb |
A15766-200ul |
Abclonal |
200 ul |
EUR 459 |
RASSF2 Rabbit pAb |
A15766-20ul |
Abclonal |
20 ul |
EUR 183 |
RASSF2 Rabbit pAb |
A15766-50ul |
Abclonal |
50 ul |
EUR 223 |
RASSF2 Rabbit pAb |
A15767-100ul |
Abclonal |
100 ul |
EUR 308 |
RASSF2 Rabbit pAb |
A15767-200ul |
Abclonal |
200 ul |
EUR 459 |
RASSF2 Rabbit pAb |
A15767-20ul |
Abclonal |
20 ul |
EUR 183 |
RASSF2 Rabbit pAb |
A15767-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RASSF2 Antibody (Center) |
APR04840G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (Center). This antibody is tested and proven to work in the following applications: |
RASSF2 Polyclonal Conjugated Antibody |
C29412 |
SAB |
100ul |
EUR 397 |
RASSF2 Polyclonal Conjugated Antibody |
C29413 |
SAB |
100ul |
EUR 397 |
RASSF2 antibody |
70R-50740 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RASSF2 antibody |
RASSF2 antibody |
23100-100ul |
SAB |
100ul |
EUR 390 |
RASSF2 antibody |
70R-13076 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal RASSF2 antibody |
RASSF2 Antibody |
DF8437 |
Affbiotech |
200ul |
EUR 304 |
Description: RASSF2 Antibody detects endogenous levels of total RASSF2. |
RASSF2 Antibody |
1-CSB-PA080062 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
RASSF2 Antibody |
1-CSB-PA019374LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IP; Recommended dilution: WB:1:1000-1:5000, IP:1:200-1:2000 |
Polyclonal RASSF2 Antibody (N-Term) |
APR04839G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (N-Term). This antibody is tested and proven to work in the following applications: |
Anti-RASSF2 antibody |
STJ95376 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to RASSF2. |
RASSF2 siRNA |
20-abx904480 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RASSF2 siRNA |
20-abx930966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RASSF2 siRNA |
20-abx930967 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RASSF2 Antibody, HRP conjugated |
1-CSB-PA019374LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RASSF2 Antibody, FITC conjugated |
1-CSB-PA019374LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RASSF2 Antibody, Biotin conjugated |
1-CSB-PA019374LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RASSF2 cloning plasmid |
CSB-CL019374HU-10ug |
Cusabio |
10ug |
EUR 384 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 981
- Sequence: atggactacagccaccaaacgtccctagtcccatgtggacaagataaatacatttccaaaaatgaacttctcttgcatctgaagacctacaacttgtactatgaaggccagaatttacagctccggcaccgggaggaagaagacgagttcattgtggaggggctcctgaacatctc
- Show more
|
Description: A cloning plasmid for the RASSF2 gene. |
RASSF2 Blocking Peptide |
20-abx063615 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RASSF2 Blocking Peptide |
DF8437-BP |
Affbiotech |
1mg |
EUR 195 |
Monoclonal RASSF2 Antibody, Clone: 1509CT269.10.9.29 |
AMM02545G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human RASSF2. The antibodies are raised in Mouse and are from clone 1509CT269.10.9.29. This antibody is applicable in FC, WB, E |
Mouse RASSF2 shRNA Plasmid |
20-abx980942 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RASSF2 shRNA Plasmid |
20-abx989674 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RASSF2 shRNA Plasmid |
20-abx956533 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RASSF2 Recombinant Protein (Human) |
RP042757 |
ABM |
100 ug |
Ask for price |
RASSF2 Recombinant Protein (Rat) |
RP223718 |
ABM |
100 ug |
Ask for price |
RASSF2 Recombinant Protein (Mouse) |
RP166970 |
ABM |
100 ug |
Ask for price |
Rassf2 ORF Vector (Rat) (pORF) |
ORF074574 |
ABM |
1.0 ug DNA |
EUR 506 |
RASSF2 ORF Vector (Human) (pORF) |
ORF014253 |
ABM |
1.0 ug DNA |
EUR 354 |
Rassf2 ORF Vector (Mouse) (pORF) |
ORF055658 |
ABM |
1.0 ug DNA |
EUR 506 |
Ras Association Domain Family Member 2 (RASSF2) Antibody |
abx145079-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ras Association Domain Family Member 2 (RASSF2) Antibody |
20-abx008392 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Ras Association Domain Family Member 2 (RASSF2) Antibody |
20-abx327652 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RASSF2 sgRNA CRISPR Lentivector set (Human) |
K1789801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rassf2 sgRNA CRISPR Lentivector set (Mouse) |
K4064401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rassf2 sgRNA CRISPR Lentivector set (Rat) |
K7318101 |
ABM |
3 x 1.0 ug |
EUR 339 |
RASSF2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1789802 |
ABM |
1.0 ug DNA |
EUR 154 |
RASSF2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1789803 |
ABM |
1.0 ug DNA |
EUR 154 |
RASSF2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1789804 |
ABM |
1.0 ug DNA |
EUR 154 |
Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4064402 |
ABM |
1.0 ug DNA |
EUR 154 |
Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4064403 |
ABM |
1.0 ug DNA |
EUR 154 |
Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4064404 |
ABM |
1.0 ug DNA |
EUR 154 |
Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7318102 |
ABM |
1.0 ug DNA |
EUR 154 |
Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7318103 |
ABM |
1.0 ug DNA |
EUR 154 |
Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7318104 |
ABM |
1.0 ug DNA |
EUR 154 |
RASSF2 Protein Vector (Human) (pPB-C-His) |
PV057009 |
ABM |
500 ng |
EUR 481 |
RASSF2 Protein Vector (Human) (pPB-N-His) |
PV057010 |
ABM |
500 ng |
EUR 481 |
RASSF2 Protein Vector (Human) (pPM-C-HA) |
PV057011 |
ABM |
500 ng |
EUR 481 |
RASSF2 Protein Vector (Human) (pPM-C-His) |
PV057012 |
ABM |
500 ng |
EUR 481 |
RASSF2 Protein Vector (Rat) (pPB-C-His) |
PV298294 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Rat) (pPB-N-His) |
PV298295 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Rat) (pPM-C-HA) |
PV298296 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Rat) (pPM-C-His) |
PV298297 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Mouse) (pPB-C-His) |
PV222630 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Mouse) (pPB-N-His) |
PV222631 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Mouse) (pPM-C-HA) |
PV222632 |
ABM |
500 ng |
EUR 603 |
RASSF2 Protein Vector (Mouse) (pPM-C-His) |
PV222633 |
ABM |
500 ng |
EUR 603 |
Rassf2 3'UTR GFP Stable Cell Line |
TU167575 |
ABM |
1.0 ml |
Ask for price |
RASSF2 3'UTR Luciferase Stable Cell Line |
TU019553 |
ABM |
1.0 ml |
EUR 2333 |
Rassf2 3'UTR Luciferase Stable Cell Line |
TU117575 |
ABM |
1.0 ml |
Ask for price |
RASSF2 3'UTR GFP Stable Cell Line |
TU069553 |
ABM |
1.0 ml |
EUR 2333 |
Rassf2 3'UTR GFP Stable Cell Line |
TU267343 |
ABM |
1.0 ml |
Ask for price |
Rassf2 3'UTR Luciferase Stable Cell Line |
TU217343 |
ABM |
1.0 ml |
Ask for price |
RASSF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV653011 |
ABM |
1.0 ug DNA |
EUR 514 |
RASSF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV653015 |
ABM |
1.0 ug DNA |
EUR 514 |
RASSF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV653016 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |