RASSF2 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

RASSF2 Polyclonal Antibody

ABP57099-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody

ABP57099-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody

ABP57099-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RASSF2 from Human, Mouse, Rat. This RASSF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RASSF2 at AA range: 80-160

RASSF2 Polyclonal Antibody

ES8098-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RASSF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RASSF2 Polyclonal Antibody

ES8098-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RASSF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RASSF2 Rabbit pAb

A15766-100ul 100 ul
EUR 308

RASSF2 Rabbit pAb

A15766-200ul 200 ul
EUR 459

RASSF2 Rabbit pAb

A15766-20ul 20 ul
EUR 183

RASSF2 Rabbit pAb

A15766-50ul 50 ul
EUR 223

RASSF2 Rabbit pAb

A15767-100ul 100 ul
EUR 308

RASSF2 Rabbit pAb

A15767-200ul 200 ul
EUR 459

RASSF2 Rabbit pAb

A15767-20ul 20 ul
EUR 183

RASSF2 Rabbit pAb

A15767-50ul 50 ul
EUR 223

Polyclonal RASSF2 Antibody (Center)

APR04840G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (Center). This antibody is tested and proven to work in the following applications:

RASSF2 Polyclonal Conjugated Antibody

C29412 100ul
EUR 397

RASSF2 Polyclonal Conjugated Antibody

C29413 100ul
EUR 397

RASSF2 antibody

23100-100ul 100ul
EUR 390

RASSF2 antibody

70R-13076 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RASSF2 antibody

RASSF2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RASSF2 Antibody

DF8437 200ul
EUR 304
Description: RASSF2 Antibody detects endogenous levels of total RASSF2.

RASSF2 antibody

70R-50740 100 ul
EUR 244
Description: Purified Polyclonal RASSF2 antibody

RASSF2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IP; Recommended dilution: WB:1:1000-1:5000, IP:1:200-1:2000

RASSF2 Antibody

ABD8437 100 ug
EUR 438

Polyclonal RASSF2 Antibody (N-Term)

APR04839G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RASSF2 (N-Term). This antibody is tested and proven to work in the following applications:

Rassf2/ Rat Rassf2 ELISA Kit

ELI-14099r 96 Tests
EUR 886

Anti-RASSF2 antibody

STJ118225 100 µl
EUR 277

Anti-RASSF2 antibody

STJ118226 100 µl
EUR 277

Anti-RASSF2 antibody

STJ95376 200 µl
EUR 197
Description: Rabbit polyclonal to RASSF2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RASSF2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RASSF2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RASSF2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RASSF2. Recognizes RASSF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RASSF2 Blocking Peptide

DF8437-BP 1mg
EUR 195

RASSF2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RASSF2 cloning plasmid

CSB-CL019374HU-10ug 10ug
EUR 384
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggactacagccaccaaacgtccctagtcccatgtggacaagataaatacatttccaaaaatgaacttctcttgcatctgaagacctacaacttgtactatgaaggccagaatttacagctccggcaccgggaggaagaagacgagttcattgtggaggggctcctgaacatctc
  • Show more
Description: A cloning plasmid for the RASSF2 gene.

Monoclonal RASSF2 Antibody, Clone: 1509CT269.10.9.29

AMM02545G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RASSF2. The antibodies are raised in Mouse and are from clone 1509CT269.10.9.29. This antibody is applicable in FC, WB, E


ELI-42789h 96 Tests
EUR 824

Rat RASSF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RASSF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RASSF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Rassf2 ELISA KIT

ELI-39170m 96 Tests
EUR 865

RASSF2 Recombinant Protein (Human)

RP042757 100 ug Ask for price

RASSF2 Recombinant Protein (Mouse)

RP166970 100 ug Ask for price

RASSF2 Recombinant Protein (Rat)

RP223718 100 ug Ask for price

Rassf2 ORF Vector (Rat) (pORF)

ORF074574 1.0 ug DNA
EUR 506

RASSF2 ORF Vector (Human) (pORF)

ORF014253 1.0 ug DNA
EUR 354

Rassf2 ORF Vector (Mouse) (pORF)

ORF055658 1.0 ug DNA
EUR 506

Ras Association Domain Family Member 2 (RASSF2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras Association Domain Family Member 2 (RASSF2) Antibody

abx145079-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras Association Domain Family Member 2 (RASSF2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rassf2 sgRNA CRISPR Lentivector set (Rat)

K7318101 3 x 1.0 ug
EUR 339

RASSF2 sgRNA CRISPR Lentivector set (Human)

K1789801 3 x 1.0 ug
EUR 339

Rassf2 sgRNA CRISPR Lentivector set (Mouse)

K4064401 3 x 1.0 ug
EUR 339

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7318102 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7318103 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7318104 1.0 ug DNA
EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1789802 1.0 ug DNA
EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1789803 1.0 ug DNA
EUR 154

RASSF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1789804 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4064402 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4064403 1.0 ug DNA
EUR 154

Rassf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4064404 1.0 ug DNA
EUR 154

RASSF2 Protein Vector (Rat) (pPB-C-His)

PV298294 500 ng
EUR 603

RASSF2 Protein Vector (Rat) (pPB-N-His)

PV298295 500 ng
EUR 603

RASSF2 Protein Vector (Rat) (pPM-C-HA)

PV298296 500 ng
EUR 603

RASSF2 Protein Vector (Rat) (pPM-C-His)

PV298297 500 ng
EUR 603

RASSF2 Protein Vector (Human) (pPB-C-His)

PV057009 500 ng
EUR 481

RASSF2 Protein Vector (Human) (pPB-N-His)

PV057010 500 ng
EUR 481

RASSF2 Protein Vector (Human) (pPM-C-HA)

PV057011 500 ng
EUR 481

RASSF2 Protein Vector (Human) (pPM-C-His)

PV057012 500 ng
EUR 481

RASSF2 Protein Vector (Mouse) (pPB-C-His)

PV222630 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPB-N-His)

PV222631 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPM-C-HA)

PV222632 500 ng
EUR 603

RASSF2 Protein Vector (Mouse) (pPM-C-His)

PV222633 500 ng
EUR 603

Rassf2 3'UTR Luciferase Stable Cell Line

TU117575 1.0 ml Ask for price

Rassf2 3'UTR GFP Stable Cell Line

TU167575 1.0 ml Ask for price

Rassf2 3'UTR Luciferase Stable Cell Line

TU217343 1.0 ml Ask for price

Rassf2 3'UTR GFP Stable Cell Line

TU267343 1.0 ml Ask for price

RASSF2 3'UTR GFP Stable Cell Line

TU069553 1.0 ml
EUR 2333

RASSF2 3'UTR Luciferase Stable Cell Line

TU019553 1.0 ml
EUR 2333

RASSF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV653011 1.0 ug DNA
EUR 514

RASSF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV653015 1.0 ug DNA
EUR 514

RASSF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV653016 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187