PRX I Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

PRX I Polyclonal Antibody

ABP53186-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I

PRX I Polyclonal Antibody

ABP57178-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody

ABP57178-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody

ABP57178-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody

ES8177-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PRX I Polyclonal Antibody

ES8177-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PRX I Polyclonal Antibody

ES4185-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX I Polyclonal Antibody

ES4185-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX I Polyclonal Conjugated Antibody

C41828 100ul
EUR 397

Anti-PRX I antibody

STJ96820 200 µl
EUR 197
Description: Rabbit polyclonal to PRX I.

Anti-PRX I antibody

STJ97366 200 µl
EUR 197
Description: Rabbit polyclonal to PRX I.

PRX Polyclonal Antibody

30158-100ul 100ul
EUR 252

PRX Polyclonal Antibody

30158-50ul 50ul
EUR 187

PRX Rabbit pAb

A17744-100ul 100 ul
EUR 308

PRX Rabbit pAb

A17744-200ul 200 ul
EUR 459

PRX Rabbit pAb

A17744-20ul 20 ul
EUR 183

PRX Rabbit pAb

A17744-50ul 50 ul
EUR 223

PRX III Polyclonal Antibody

41363-100ul 100ul
EUR 252

PRX III Polyclonal Antibody

41363-50ul 50ul
EUR 187

PRX Polyclonal Conjugated Antibody

C30158 100ul
EUR 397

PRX III Polyclonal Antibody

ABP52267-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX III Polyclonal Antibody

ABP52267-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX III Polyclonal Antibody

ABP52267-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX II Polyclonal Antibody

ABP56362-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody

ABP56362-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody

ABP56362-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody

ES7361-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRX II Polyclonal Antibody

ES7361-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRX III Polyclonal Antibody

ES3266-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX III Polyclonal Antibody

ES3266-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX Antibody

1-CSB-PA018656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRX. Recognizes PRX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PRX III Polyclonal Conjugated Antibody

C41363 100ul
EUR 397

Prx III antibody

70R-21656 50 ul
EUR 435
Description: Rabbit polyclonal Prx III antibody

Anti-PRX Antibody

A01686 100ug/vial
EUR 334

Anti-PRX antibody

STJ119785 100 µl
EUR 277
Description: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

IGF-I Polyclonal Antibody (Rabbit)

PABCa 1 mg
EUR 299

Prx/ Rat Prx ELISA Kit

ELI-19663r 96 Tests
EUR 886

Human Kinase Library I

HKIN-I 1 set
EUR 450

Human Drug Detoxication I

HDTX-I 1 set
EUR 548

PRX-08066

B1200-5 5 mg
EUR 448
Description: PRX-08066 is a selective antagonist of 5-hydroxytryptamine receptor 2B (5-HT2BR) with Ki value of 3.4nM [1].PRX-08066 is found to causes selective vasodilation of pulmonary arteries and is developed to treat for pulmonary arterial hypertension (PAH).

PRX siRNA

20-abx904297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRX siRNA

20-abx930081
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRX siRNA

20-abx930082
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRX-08066

HY-15472 5mg
EUR 291

Human Cytokine Primer Library I

HCA-I 1 set
EUR 450

Mouse Cytokine Primer Library I

MCA-I 1 set
EUR 450

Rat Cytokine Primer Library I

RCA-I 1 set
EUR 548

Rabbit Anti Rig-I Polyclonal Antibody

CPBT-65259RR 0.1 mg
EUR 663

Human IGF-I Polyclonal Antibody (Rabbit)

PAA2 400 µg
EUR 299

Anti-PRX II antibody

STJ95237 200 µl
EUR 197
Description: Rabbit polyclonal to PRX II.

Anti-PRX III antibody

STJ95238 200 µl
EUR 197
Description: Rabbit polyclonal to PRX III.

Human Colon Cancer Primer Library I

HCCP-I 1 set
EUR 548

Human DNA Repair Primer Library I

HDRL-I 1 set
EUR 548

Human Drug Transporter I Primer Library

HDTP-I 1 set
EUR 548

Mouse DNA Repair Primer Library I

MDRL-I 1 set
EUR 645

Polyclonal Rabbit anti-Troponin I

TnI 50 uL
EUR 280

Human Interferon Type I Signaling Primer Library

HIFN-I 1 set
EUR 548

Human Cancer Driver Gene I Primer Library

HCDG-I 1 set
EUR 645

Rabbit Anti-Complement Factor I Polyclonal Antibody

CTA-335-100ug 100ug Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Complement Factor I Polyclonal Antibody

CTA-335-1mg 1mg Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti Human I-Tac Polyclonal Antibody

CPBT-65168RH 0.1 mg
EUR 881

Rabbit Anti Chicken Collagen I Polyclonal Antibody

CPBT-67349RC 0.5 ml
EUR 861

Rabbit Anti Human Annexin I Polyclonal Antibody

CPBT-67390RH 0.1 mg
EUR 767

Rabbit Anti Human Collagen I Polyclonal Antibody

CPBT-67896RH 50 µg
EUR 944

Rabbit Anti Rat Collagen I Polyclonal Antibody

CPBT-67923RR 0.5 ml
EUR 767

Rabbit Anti Mouse Collagen I Polyclonal Antibody

CPBT-68065RM 0.1 ml
EUR 840

PRX cloning plasmid

CSB-CL018833HU-10ug 10ug
EUR 1715
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4386
  • Sequence: atggaggccaggagccggagtgccgaggagctgaggcgggcggagttggtggaaattatcgtggagacggaggcgcagaccggggtcagcggcatcaacgtagcgggcggcggcaaagagggaatcttcgttcgggagctgcgcgaggactcacccgccgccaggagcctcagcc
  • Show more
Description: A cloning plasmid for the PRX gene.

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)

TG2012-2 250 ul
EUR 380

Rabbit Anti Phap I (C-Terminal) Polyclonal Antibody

CPBT-66414RP 0.1 mg
EUR 663

Rabbit Anti Bovine Collagen I/Iii Polyclonal Antibody

CPBT-67295RB 0.5 ml
EUR 767

Rabbit Anti Dog Collagen I/Iii Polyclonal Antibody

CPBT-67318RD 0.5 ml
EUR 767

Rabbit Anti Human Collagen I/Iii Polyclonal Antibody

CPBT-67898RH 0.5 ml
EUR 767

Human PRX ELISA Kit

ELA-E13230h 96 Tests
EUR 824

PRX ELISA KIT|Human

EF005289 96 Tests
EUR 689

Mouse PRX shRNA Plasmid

20-abx972229
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PRX shRNA Plasmid

20-abx986471
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PRX shRNA Plasmid

20-abx961655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRX-08066 Maleic acid

A2098-10 10 mg
EUR 608
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

PRX-08066 Maleic acid

A2098-5 5 mg
EUR 457
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

PRX-08066 Maleic acid

A2098-5.1 10 mM (in 1mL DMSO)
EUR 893
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

Collagen I Polyclonal Antibody

46888-100ul 100ul
EUR 252

Collagen I Polyclonal Antibody

46888-50ul 50ul
EUR 187

HXK I Polyclonal Antibody

41049-100ul 100ul
EUR 252

HXK I Polyclonal Antibody

41049-50ul 50ul
EUR 187

Synapsin I Polyclonal Antibody

41470-100ul 100ul
EUR 252

Synapsin I Polyclonal Antibody

41470-50ul 50ul
EUR 187

ApoA-I Polyclonal Antibody

41817-100ul 100ul
EUR 252

ApoA-I Polyclonal Antibody

41817-50ul 50ul
EUR 187

ANG I Polyclonal Antibody

41909-100ul 100ul
EUR 252

ANG I Polyclonal Antibody

41909-50ul 50ul
EUR 187

I-FABP Polyclonal Antibody

46763-100ul 100ul
EUR 252

I-FABP Polyclonal Antibody

46763-50ul 50ul
EUR 187

ANG I Polyclonal Antibody

46795-100ul 100ul
EUR 252

ANG I Polyclonal Antibody

46795-50ul 50ul
EUR 187

Annexin I Polyclonal Antibody

40590-100ul 100ul
EUR 252

Annexin I Polyclonal Antibody

40590-50ul 50ul
EUR 187

Annexin I Polyclonal Antibody

40591-100ul 100ul
EUR 252

Annexin I Polyclonal Antibody

40591-50ul 50ul
EUR 187

Polyclonal Synaptotagmin I Antibody

APG00323G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Synaptotagmin I . This antibody is tested and proven to work in the following applications:

Polyclonal IGF-I Antibody

APR00268G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications:

Polyclonal Synaptotagmin-I Antibody

AMM08056G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synaptotagmin-I . This antibody is tested and proven to work in the following applications:

I?B-? Polyclonal Antibody

ABP55388-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
  • Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22

I?B-? Polyclonal Antibody

ABP55388-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
  • Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22

I?B-? Polyclonal Antibody

ABP55388-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
  • Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22

Neurophysin I Polyclonal Antibody

ABP55453-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
  • Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I

Neurophysin I Polyclonal Antibody

ABP55453-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
  • Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I

Neurophysin I Polyclonal Antibody

ABP55453-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
  • Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I

Collagen I Polyclonal Antibody

ABP58229-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542

Collagen I Polyclonal Antibody

ABP58229-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542

Collagen I Polyclonal Antibody

ABP58229-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542

Collagen I Polyclonal Antibody

ABP58230-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein

Collagen I Polyclonal Antibody

ABP58230-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein

Collagen I Polyclonal Antibody

ABP58230-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein

I?B ? Polyclonal Antibody

EA213-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC

I?B ? Polyclonal Antibody

EA213-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC

Polyclonal Synapsin I Antibody

APR13608G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:

Polyclonal Synapsin I Antibody

APR13609G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:

Polyclonal Synapsin I Antibody

APR13610G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:

Polyclonal IGF-I Antibody

APR07952G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications:

Polyclonal PHAP I Antibody

APR09079G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications:

Polyclonal PHAP I Antibody

APR09080G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications:

Dynamin I Polyclonal Antibody

ABP54012-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778

Dynamin I Polyclonal Antibody

ABP54012-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778

Dynamin I Polyclonal Antibody

ABP54012-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778

Synapsin I Polyclonal Antibody

ABP52532-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9

Synapsin I Polyclonal Antibody

ABP52532-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9

Synapsin I Polyclonal Antibody

ABP52532-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9

ApoA-I Polyclonal Antibody

ABP53170-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoA-I
  • Applications tips:
Description: A polyclonal antibody for detection of ApoA-I from Human, Mouse. This ApoA-I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoA-I

ApoA-I Polyclonal Antibody

ABP53170-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoA-I
  • Applications tips:
Description: A polyclonal antibody for detection of ApoA-I from Human, Mouse. This ApoA-I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoA-I

ApoA-I Polyclonal Antibody

ABP53170-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoA-I
  • Applications tips:
Description: A polyclonal antibody for detection of ApoA-I from Human, Mouse. This ApoA-I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoA-I

ANG I Polyclonal Antibody

ABP53274-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ANG I
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ANG I

ANG I Polyclonal Antibody

ABP53274-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ANG I
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ANG I

ANG I Polyclonal Antibody

ABP53274-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ANG I
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ANG I

Dynamin I Polyclonal Antibody

ABP51209-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774

Dynamin I Polyclonal Antibody

ABP51209-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774

Dynamin I Polyclonal Antibody

ABP51209-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774

HXK I Polyclonal Antibody

ABP51588-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of HXK I from Human, Mouse, Rat. This HXK I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80

HXK I Polyclonal Antibody

ABP51588-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of HXK I from Human, Mouse, Rat. This HXK I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80

HXK I Polyclonal Antibody

ABP51588-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of HXK I from Human, Mouse, Rat. This HXK I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80

Synapsin I Polyclonal Antibody

ABP-PAB-22036 100 ug Ask for price
    • Product line: Pan-specific Antibodies
    • Brand:

Amphiphysin I Polyclonal Antibody

ABP50648-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of Amphiphysin I from Human, Mouse, Rat. This Amphiphysin I antibody is for WB , ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180

Amphiphysin I Polyclonal Antibody

ABP50648-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of Amphiphysin I from Human, Mouse, Rat. This Amphiphysin I antibody is for WB , ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180

Amphiphysin I Polyclonal Antibody

ABP50648-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of Amphiphysin I from Human, Mouse, Rat. This Amphiphysin I antibody is for WB , ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180

Annexin I Polyclonal Antibody

ABP50656-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Annexin I
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human, Mouse, Rat. This Annexin I antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Annexin I

Annexin I Polyclonal Antibody

ABP50656-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Annexin I
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human, Mouse, Rat. This Annexin I antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Annexin I

Annexin I Polyclonal Antibody

ABP50656-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Annexin I
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human, Mouse, Rat. This Annexin I antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Annexin I

Arylsulfatase I Polyclonal Antibody

ABP50712-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of Arylsulfatase I from Human, Monkey. This Arylsulfatase I antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360

Arylsulfatase I Polyclonal Antibody

ABP50712-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of Arylsulfatase I from Human, Monkey. This Arylsulfatase I antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360

Arylsulfatase I Polyclonal Antibody

ABP50712-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of Arylsulfatase I from Human, Monkey. This Arylsulfatase I antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360

GnRH I Polyclonal Antibody

ABP54571-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GnRH I
  • Applications tips:
Description: A polyclonal antibody for detection of GnRH I from Human. This GnRH I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GnRH I

GnRH I Polyclonal Antibody

ABP54571-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GnRH I
  • Applications tips:
Description: A polyclonal antibody for detection of GnRH I from Human. This GnRH I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GnRH I

GnRH I Polyclonal Antibody

ABP54571-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GnRH I
  • Applications tips:
Description: A polyclonal antibody for detection of GnRH I from Human. This GnRH I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GnRH I

Annexin I Polyclonal Antibody

ABP54713-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21

Annexin I Polyclonal Antibody

ABP54713-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21

Annexin I Polyclonal Antibody

ABP54713-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21

Factor I Polyclonal Antibody

ABP54826-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Factor I from Human. This Factor I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490

Factor I Polyclonal Antibody

ABP54826-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Factor I from Human. This Factor I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490

Factor I Polyclonal Antibody

ABP54826-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Factor I from Human. This Factor I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490

IGF-I Polyclonal Antibody

ABP54846-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF-I
  • Applications tips:
Description: A polyclonal antibody for detection of IGF-I from Human, Mouse, Rat. This IGF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF-I

IGF-I Polyclonal Antibody

ABP54846-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF-I
  • Applications tips:
Description: A polyclonal antibody for detection of IGF-I from Human, Mouse, Rat. This IGF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF-I

IGF-I Polyclonal Antibody

ABP54846-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF-I
  • Applications tips:
Description: A polyclonal antibody for detection of IGF-I from Human, Mouse, Rat. This IGF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF-I

IP3R-I Polyclonal Antibody

ABP54966-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598

IP3R-I Polyclonal Antibody

ABP54966-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598

IP3R-I Polyclonal Antibody

ABP54966-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598

Arginase I Polyclonal Antibody

ABP55029-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Arginase I from Human. This Arginase I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110

Arginase I Polyclonal Antibody

ABP55029-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Arginase I from Human. This Arginase I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110

Arginase I Polyclonal Antibody

ABP55029-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Arginase I from Human. This Arginase I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110

IP3R-I Polyclonal Antibody

ABP57355-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764

IP3R-I Polyclonal Antibody

ABP57355-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764

IP3R-I Polyclonal Antibody

ABP57355-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764

Collagen I Polyclonal Antibody

ABP57494-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217

Collagen I Polyclonal Antibody

ABP57494-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217

Collagen I Polyclonal Antibody

ABP57494-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217

ANG I Polyclonal Antibody

ABP57761-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60

ANG I Polyclonal Antibody

ABP57761-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60

ANG I Polyclonal Antibody

ABP57761-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60

Annexin I Polyclonal Antibody

ABP57766-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180

Annexin I Polyclonal Antibody

ABP57766-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180

Annexin I Polyclonal Antibody

ABP57766-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180

Synapsin I Polyclonal Antibody

ABP56327-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605

Synapsin I Polyclonal Antibody

ABP56327-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605

Synapsin I Polyclonal Antibody

ABP56327-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605

Synapsin I Polyclonal Antibody

ABP56328-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62

Synapsin I Polyclonal Antibody

ABP56328-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62

Synapsin I Polyclonal Antibody

ABP56328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62

Topo I Polyclonal Antibody

ABP56413-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Topo I
  • Applications tips:
Description: A polyclonal antibody for detection of Topo I from Human, Mouse, Rat. This Topo I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Topo I

Topo I Polyclonal Antibody

ABP56413-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Topo I
  • Applications tips:
Description: A polyclonal antibody for detection of Topo I from Human, Mouse, Rat. This Topo I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Topo I

Topo I Polyclonal Antibody

ABP56413-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Topo I
  • Applications tips:
Description: A polyclonal antibody for detection of Topo I from Human, Mouse, Rat. This Topo I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Topo I

TTF-I Polyclonal Antibody

ABP56458-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TTF-I from Human. This TTF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90

TTF-I Polyclonal Antibody

ABP56458-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TTF-I from Human. This TTF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90

TTF-I Polyclonal Antibody

ABP56458-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TTF-I from Human. This TTF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90

CA I Polyclonal Antibody

ABP56543-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CA I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CA I from Human. This CA I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CA I at AA range: 10-90

CA I Polyclonal Antibody

ABP56543-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CA I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CA I from Human. This CA I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CA I at AA range: 10-90

CA I Polyclonal Antibody

ABP56543-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CA I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CA I from Human. This CA I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CA I at AA range: 10-90

Neurexin I Polyclonal Antibody

ABP57031-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560

Neurexin I Polyclonal Antibody

ABP57031-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560

Neurexin I Polyclonal Antibody

ABP57031-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560