PRX I Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

PRX I Polyclonal Antibody

ABP53186-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I

PRX I Polyclonal Antibody

ABP57178-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody

ABP57178-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody

ABP57178-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

PRX I Polyclonal Antibody

ES8177-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PRX I Polyclonal Antibody

ES8177-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PRX I Polyclonal Antibody

ES4185-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX I Polyclonal Antibody

ES4185-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX I Polyclonal Conjugated Antibody

C41828 100ul
EUR 397

Anti-PRX I antibody

STJ96820 200 µl
EUR 197
Description: Rabbit polyclonal to PRX I.

Anti-PRX I antibody

STJ97366 200 µl
EUR 197
Description: Rabbit polyclonal to PRX I.

PRX Polyclonal Antibody

30158-100ul 100ul
EUR 252

PRX Polyclonal Antibody

30158-50ul 50ul
EUR 187

PRX Rabbit pAb

A17744-100ul 100 ul
EUR 308

PRX Rabbit pAb

A17744-200ul 200 ul
EUR 459

PRX Rabbit pAb

A17744-20ul 20 ul
EUR 183

PRX Rabbit pAb

A17744-50ul 50 ul
EUR 223

PRX III Polyclonal Antibody

41363-100ul 100ul
EUR 252

PRX III Polyclonal Antibody

41363-50ul 50ul
EUR 187

PRX Polyclonal Conjugated Antibody

C30158 100ul
EUR 397

PRX III Polyclonal Antibody

ABP52267-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX III Polyclonal Antibody

ABP52267-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX III Polyclonal Antibody

ABP52267-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III

PRX II Polyclonal Antibody

ABP56362-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody

ABP56362-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody

ABP56362-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II

PRX II Polyclonal Antibody

ES7361-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRX II Polyclonal Antibody

ES7361-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRX III Polyclonal Antibody

ES3266-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX III Polyclonal Antibody

ES3266-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PRX Antibody

1-CSB-PA018656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRX. Recognizes PRX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PRX III Polyclonal Conjugated Antibody

C41363 100ul
EUR 397

Prx III antibody

70R-21656 50 ul
EUR 435
Description: Rabbit polyclonal Prx III antibody

Anti-PRX Antibody

A01686 100ug/vial
EUR 334

Anti-PRX antibody

STJ119785 100 µl
EUR 277
Description: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

IGF-I Polyclonal Antibody (Rabbit)

PABCa 1 mg
EUR 299

Prx/ Rat Prx ELISA Kit

ELI-19663r 96 Tests
EUR 886

Human Kinase Library I

HKIN-I 1 set
EUR 450

Human Drug Detoxication I

HDTX-I 1 set
EUR 548

PRX siRNA

20-abx904297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRX siRNA

20-abx930081
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRX siRNA

20-abx930082
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRX-08066

HY-15472 5mg
EUR 291

Human Cytokine Primer Library I

HCA-I 1 set
EUR 450

Mouse Cytokine Primer Library I

MCA-I 1 set
EUR 450

Rat Cytokine Primer Library I

RCA-I 1 set
EUR 548

Rabbit Anti Rig-I Polyclonal Antibody

CPBT-65259RR 0.1 mg
EUR 663

Human IGF-I Polyclonal Antibody (Rabbit)

PAA2 400 µg
EUR 299

Anti-PRX II antibody

STJ95237 200 µl
EUR 197
Description: Rabbit polyclonal to PRX II.

Anti-PRX III antibody

STJ95238 200 µl
EUR 197
Description: Rabbit polyclonal to PRX III.

Human Colon Cancer Primer Library I

HCCP-I 1 set
EUR 548

Human DNA Repair Primer Library I

HDRL-I 1 set
EUR 548

Human Drug Transporter I Primer Library

HDTP-I 1 set
EUR 548

Mouse DNA Repair Primer Library I

MDRL-I 1 set
EUR 645

Polyclonal Rabbit anti-Troponin I

TnI 50 uL
EUR 280

Human Interferon Type I Signaling Primer Library

HIFN-I 1 set
EUR 548

Human Cancer Driver Gene I Primer Library

HCDG-I 1 set
EUR 645

Rabbit Anti-Complement Factor I Polyclonal Antibody

CTA-335-100ug 100ug Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-Complement Factor I Polyclonal Antibody

CTA-335-1mg 1mg Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti Human I-Tac Polyclonal Antibody

CPBT-65168RH 0.1 mg
EUR 881

Rabbit Anti Chicken Collagen I Polyclonal Antibody

CPBT-67349RC 0.5 ml
EUR 861

Rabbit Anti Human Annexin I Polyclonal Antibody

CPBT-67390RH 0.1 mg
EUR 767

Rabbit Anti Human Collagen I Polyclonal Antibody

CPBT-67896RH 50 µg
EUR 944

Rabbit Anti Rat Collagen I Polyclonal Antibody

CPBT-67923RR 0.5 ml
EUR 767

Rabbit Anti Mouse Collagen I Polyclonal Antibody

CPBT-68065RM 0.1 ml
EUR 840

PRX cloning plasmid

CSB-CL018833HU-10ug 10ug
EUR 1715
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4386
  • Sequence: atggaggccaggagccggagtgccgaggagctgaggcgggcggagttggtggaaattatcgtggagacggaggcgcagaccggggtcagcggcatcaacgtagcgggcggcggcaaagagggaatcttcgttcgggagctgcgcgaggactcacccgccgccaggagcctcagcc
  • Show more
Description: A cloning plasmid for the PRX gene.

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)

TG2012-2 250 ul
EUR 380

Rabbit Anti Phap I (C-Terminal) Polyclonal Antibody

CPBT-66414RP 0.1 mg
EUR 663

Rabbit Anti Bovine Collagen I/Iii Polyclonal Antibody

CPBT-67295RB 0.5 ml
EUR 767

Rabbit Anti Dog Collagen I/Iii Polyclonal Antibody

CPBT-67318RD 0.5 ml
EUR 767

Rabbit Anti Human Collagen I/Iii Polyclonal Antibody

CPBT-67898RH 0.5 ml
EUR 767

Human PRX ELISA Kit

ELA-E13230h 96 Tests
EUR 824

PRX ELISA KIT|Human

EF005289 96 Tests
EUR 689

Mouse PRX shRNA Plasmid

20-abx972229
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PRX shRNA Plasmid

20-abx986471
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PRX shRNA Plasmid

20-abx961655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRX-08066 Maleic acid

A2098-10 10 mg
EUR 608
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

PRX-08066 Maleic acid

A2098-5 5 mg
EUR 457
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

PRX-08066 Maleic acid

A2098-5.1 10 mM (in 1mL DMSO)
EUR 893
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].

Collagen I Polyclonal Antibody

46888-100ul 100ul
EUR 252

Collagen I Polyclonal Antibody

46888-50ul 50ul
EUR 187

HXK I Polyclonal Antibody

41049-100ul 100ul
EUR 252

HXK I Polyclonal Antibody

41049-50ul 50ul
EUR 187

Synapsin I Polyclonal Antibody

41470-100ul 100ul
EUR 252

Synapsin I Polyclonal Antibody

41470-50ul 50ul
EUR 187

ApoA-I Polyclonal Antibody

41817-100ul 100ul
EUR 252

ApoA-I Polyclonal Antibody

41817-50ul 50ul
EUR 187

ANG I Polyclonal Antibody

41909-100ul 100ul
EUR 252

ANG I Polyclonal Antibody

41909-50ul 50ul
EUR 187

I-FABP Polyclonal Antibody

46763-100ul 100ul
EUR 252

I-FABP Polyclonal Antibody

46763-50ul 50ul
EUR 187

ANG I Polyclonal Antibody

46795-100ul 100ul
EUR 252

ANG I Polyclonal Antibody

46795-50ul 50ul
EUR 187

Annexin I Polyclonal Antibody

40590-100ul 100ul
EUR 252

Annexin I Polyclonal Antibody

40590-50ul 50ul
EUR 187

Annexin I Polyclonal Antibody

40591-100ul 100ul
EUR 252