Order Now: brent@sdlifesciences.com
PRX I Polyclonal Antibody |
ABP57178-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PRX I Polyclonal Antibody |
ABP57178-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PRX I Polyclonal Antibody |
ABP57178-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PRX I Polyclonal Antibody |
ABP53186-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I |
PRX I Polyclonal Antibody |
ABP53186-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I |
PRX I Polyclonal Antibody |
ABP53186-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I |
PRX I Polyclonal Antibody |
41828-100ul |
SAB |
100ul |
EUR 252 |
PRX I Polyclonal Antibody |
41828-50ul |
SAB |
50ul |
EUR 187 |
PRX I Polyclonal Conjugated Antibody |
C41828 |
SAB |
100ul |
EUR 397 |
Anti-PRX I antibody |
STJ96820 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PRX I. |
Anti-PRX I antibody |
STJ97366 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PRX I. |
PRX Polyclonal Antibody |
30158-100ul |
SAB |
100ul |
EUR 252 |
PRX Polyclonal Antibody |
30158-50ul |
SAB |
50ul |
EUR 187 |
PRX Rabbit pAb |
A17744-100ul |
Abclonal |
100 ul |
EUR 308 |
PRX Rabbit pAb |
A17744-200ul |
Abclonal |
200 ul |
EUR 459 |
PRX Rabbit pAb |
A17744-20ul |
Abclonal |
20 ul |
EUR 183 |
PRX Rabbit pAb |
A17744-50ul |
Abclonal |
50 ul |
EUR 223 |
PRX Polyclonal Conjugated Antibody |
C30158 |
SAB |
100ul |
EUR 397 |
PRX II Polyclonal Antibody |
ES7361-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PRX II Polyclonal Antibody |
ES7361-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PRX III Polyclonal Antibody |
ES3266-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
PRX III Polyclonal Antibody |
ES3266-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
PRX III Polyclonal Antibody |
ABP52267-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III |
PRX III Polyclonal Antibody |
ABP52267-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III |
PRX III Polyclonal Antibody |
ABP52267-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III |
PRX II Polyclonal Antibody |
ABP56362-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II |
PRX II Polyclonal Antibody |
ABP56362-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II |
PRX II Polyclonal Antibody |
ABP56362-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
- Applications tips:
|
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II |
PRX III Polyclonal Antibody |
41363-100ul |
SAB |
100ul |
EUR 252 |
PRX III Polyclonal Antibody |
41363-50ul |
SAB |
50ul |
EUR 187 |
PRX Antibody |
1-CSB-PA018656GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PRX. Recognizes PRX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PRX III Polyclonal Conjugated Antibody |
C41363 |
SAB |
100ul |
EUR 397 |
Anti-PRX Antibody |
A01686 |
BosterBio |
100ug/vial |
EUR 334 |
Prx III antibody |
70R-21656 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal Prx III antibody |
Anti-PRX antibody |
STJ119785 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008] |
IGF-I Polyclonal Antibody (Rabbit) |
PABCa |
GroPep |
1 mg |
EUR 299 |
PRX siRNA |
20-abx904297 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRX-08066 |
B1200-5 |
ApexBio |
5 mg |
EUR 448 |
Description: PRX-08066 is a selective antagonist of 5-hydroxytryptamine receptor 2B (5-HT2BR) with Ki value of 3.4nM [1].PRX-08066 is found to causes selective vasodilation of pulmonary arteries and is developed to treat for pulmonary arterial hypertension (PAH). |
PRX siRNA |
20-abx930081 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRX siRNA |
20-abx930082 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human IGF-I Polyclonal Antibody (Rabbit) |
PAA2 |
GroPep |
400 µg |
EUR 299 |
Anti-PRX II antibody |
STJ95237 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PRX II. |
Anti-PRX III antibody |
STJ95238 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PRX III. |
Polyclonal Rabbit anti-Troponin I |
TnI |
Detroit R&D |
50 uL |
EUR 280 |
Human Interferon Type I Signaling Primer Library |
HIFN-I |
Real Time Primers |
1 set |
EUR 548 |
Rabbit Anti-Complement Factor I Polyclonal Antibody |
CTA-335-100ug |
Creative Biolabs |
100ug |
Ask for price |
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P. |
Rabbit Anti-Complement Factor I Polyclonal Antibody |
CTA-335-1mg |
Creative Biolabs |
1mg |
Ask for price |
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P. |
PRX cloning plasmid |
CSB-CL018833HU-10ug |
Cusabio |
10ug |
EUR 1715 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4386
- Sequence: atggaggccaggagccggagtgccgaggagctgaggcgggcggagttggtggaaattatcgtggagacggaggcgcagaccggggtcagcggcatcaacgtagcgggcggcggcaaagagggaatcttcgttcgggagctgcgcgaggactcacccgccgccaggagcctcagcc
- Show more
|
Description: A cloning plasmid for the PRX gene. |
Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum) |
TG2012-2 |
TopoGen |
250 ul |
EUR 380 |
Rabbit Anti Phap I (C-Terminal) Polyclonal Antibody |
CPBT-66414RP |
Creative Diagnostics |
0.1 mg |
EUR 663 |
Rabbit Anti Bovine Collagen I/Iii Polyclonal Antibody |
CPBT-67295RB |
Creative Diagnostics |
0.5 ml |
EUR 767 |
Rabbit Anti Human Collagen I/Iii Polyclonal Antibody |
CPBT-67898RH |
Creative Diagnostics |
0.5 ml |
EUR 767 |
Rat PRX shRNA Plasmid |
20-abx986471 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PRX-08066 Maleic acid |
A2098-10 |
ApexBio |
10 mg |
EUR 608 |
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1]. |
PRX-08066 Maleic acid |
A2098-5 |
ApexBio |
5 mg |
EUR 457 |
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1]. |
PRX-08066 Maleic acid |
A2098-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 893 |
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1]. |
Mouse PRX shRNA Plasmid |
20-abx972229 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PRX shRNA Plasmid |
20-abx961655 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polyclonal IGF-I Antibody |
APR00268G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications: |
Polyclonal IGF-I Antibody |
APR07952G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications: |
Polyclonal PHAP I Antibody |
APR09079G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications: |
Polyclonal PHAP I Antibody |
APR09080G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications: |
Polyclonal Synaptotagmin-I Antibody |
AMM08056G |
Leading Biology |
0.05ml |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synaptotagmin-I . This antibody is tested and proven to work in the following applications: |
Polyclonal Synaptotagmin I Antibody |
APG00323G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Synaptotagmin I . This antibody is tested and proven to work in the following applications: |
Polyclonal Synapsin I Antibody |
APR13608G |
Leading Biology |
0.1mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications: |
Polyclonal Synapsin I Antibody |
APR13609G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications: |
Polyclonal Synapsin I Antibody |
APR13610G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications: |
I?B ? Polyclonal Antibody |
EA213-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC |
I?B ? Polyclonal Antibody |
EA213-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC |
Amphiphysin I Polyclonal Antibody |
ES1647-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Amphiphysin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Amphiphysin I Polyclonal Antibody |
ES1647-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Amphiphysin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Annexin I Polyclonal Antibody |
ES1655-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Annexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Annexin I Polyclonal Antibody |
ES1655-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Annexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Arylsulfatase I Polyclonal Antibody |
ES1711-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Arylsulfatase I from Human/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Arylsulfatase I Polyclonal Antibody |
ES1711-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Arylsulfatase I from Human/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Dynamin I Polyclonal Antibody |
ES2208-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Dynamin I Polyclonal Antibody |
ES2208-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
HXK I Polyclonal Antibody |
ES2587-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HXK I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
HXK I Polyclonal Antibody |
ES2587-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HXK I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES2652-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
I?B-? Polyclonal Antibody |
ES2652-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
I?B-? Polyclonal Antibody |
ES2653-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES2653-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Dynamin I Polyclonal Antibody |
ES5011-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
Dynamin I Polyclonal Antibody |
ES5011-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Dynamin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
GnRH I Polyclonal Antibody |
ES5570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GnRH I from Human. This antibody is tested and validated for IHC, WB, ELISA |
GnRH I Polyclonal Antibody |
ES5570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GnRH I from Human. This antibody is tested and validated for IHC, WB, ELISA |
Annexin I Polyclonal Antibody |
ES5712-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Annexin I Polyclonal Antibody |
ES5712-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Factor I Polyclonal Antibody |
ES5825-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Factor I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Factor I Polyclonal Antibody |
ES5825-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Factor I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IGF-I Polyclonal Antibody |
ES5845-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IGF-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
IGF-I Polyclonal Antibody |
ES5845-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IGF-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
IP3R-I Polyclonal Antibody |
ES5965-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA |
IP3R-I Polyclonal Antibody |
ES5965-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA |
Arginase I Polyclonal Antibody |
ES6028-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Arginase I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Arginase I Polyclonal Antibody |
ES6028-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Arginase I from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6382-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6382-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6383-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6383-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6385-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6385-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6387-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
I?B-? Polyclonal Antibody |
ES6387-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Neurophysin I Polyclonal Antibody |
ES6452-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neurophysin I from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neurophysin I Polyclonal Antibody |
ES6452-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neurophysin I from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Endophilin I Polyclonal Antibody |
ES7184-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Endophilin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Endophilin I Polyclonal Antibody |
ES7184-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Endophilin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Synapsin I Polyclonal Antibody |
ES7326-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA |
Synapsin I Polyclonal Antibody |
ES7326-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for IHC, IF, WB, ELISA |
Synapsin I Polyclonal Antibody |
ES7327-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Synapsin I Polyclonal Antibody |
ES7327-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Topo I Polyclonal Antibody |
ES7412-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Topo I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Topo I Polyclonal Antibody |
ES7412-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Topo I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TTF-I Polyclonal Antibody |
ES7457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TTF-I from Human. This antibody is tested and validated for IHC, WB, ELISA |
TTF-I Polyclonal Antibody |
ES7457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TTF-I from Human. This antibody is tested and validated for IHC, WB, ELISA |
CA I Polyclonal Antibody |
ES7542-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CA I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CA I Polyclonal Antibody |
ES7542-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CA I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neurexin I Polyclonal Antibody |
ES8030-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neurexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Neurexin I Polyclonal Antibody |
ES8030-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neurexin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
I?B-? Polyclonal Antibody |
ES8242-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC |
I?B-? Polyclonal Antibody |
ES8242-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I?B-? from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IP3R-I Polyclonal Antibody |
ES8348-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IP3R-I Polyclonal Antibody |
ES8348-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IP3R-I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Collagen I Polyclonal Antibody |
ES8487-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Collagen I Polyclonal Antibody |
ES8487-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Annexin I Polyclonal Antibody |
ES8636-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Annexin I Polyclonal Antibody |
ES8636-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Annexin I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
I-FABP Polyclonal Antibody |
ES8641-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against I-FABP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
I-FABP Polyclonal Antibody |
ES8641-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against I-FABP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ANG I Polyclonal Antibody |
ES8656-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for IHC, WB, ELISA |
ANG I Polyclonal Antibody |
ES8656-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for IHC, WB, ELISA |
Collagen I Polyclonal Antibody |
ES8844-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Collagen I Polyclonal Antibody |
ES8844-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Collagen I Polyclonal Antibody |
ES8915-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Collagen I Polyclonal Antibody |
ES8915-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Collagen I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIPK I ? Polyclonal Antibody |
ES3212-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PIPK I ? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIPK I ? Polyclonal Antibody |
ES3212-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PIPK I ? from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Synapsin I Polyclonal Antibody |
ES3531-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Synapsin I Polyclonal Antibody |
ES3531-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Synapsin I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
ApoA-I Polyclonal Antibody |
ES4169-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ApoA-I from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ApoA-I Polyclonal Antibody |
ES4169-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ApoA-I from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ANG I Polyclonal Antibody |
ES4273-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ANG I Polyclonal Antibody |
ES4273-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ANG I from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Synapsin I Polyclonal Antibody |
ABP52532-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
- Applications tips:
|
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9 |
Synapsin I Polyclonal Antibody |
ABP52532-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
- Applications tips:
|
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9 |
Synapsin I Polyclonal Antibody |
ABP52532-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
- Applications tips:
|
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9 |
Neurexin I Polyclonal Antibody |
ABP57031-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560 |
Neurexin I Polyclonal Antibody |
ABP57031-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560 |
Neurexin I Polyclonal Antibody |
ABP57031-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurexin I from Human, Mouse, Rat. This Neurexin I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexin I at AA range: 480-560 |
IP3R-I Polyclonal Antibody |
ABP57355-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
- Applications tips:
|
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764 |
IP3R-I Polyclonal Antibody |
ABP57355-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
- Applications tips:
|
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764 |
IP3R-I Polyclonal Antibody |
ABP57355-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
- Applications tips:
|
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764 |
Collagen I Polyclonal Antibody |
ABP57494-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
- Applications tips:
|
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217 |
Collagen I Polyclonal Antibody |
ABP57494-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
- Applications tips:
|
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217 |
Collagen I Polyclonal Antibody |
ABP57494-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
- Applications tips:
|
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217 |
ANG I Polyclonal Antibody |
ABP57761-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
- Applications tips:
|
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60 |
ANG I Polyclonal Antibody |
ABP57761-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
- Applications tips:
|
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60 |
ANG I Polyclonal Antibody |
ABP57761-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
- Applications tips:
|
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60 |
Annexin I Polyclonal Antibody |
ABP57766-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
- Applications tips:
|
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180 |
Annexin I Polyclonal Antibody |
ABP57766-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
- Applications tips:
|
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180 |
Annexin I Polyclonal Antibody |
ABP57766-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
- Applications tips:
|
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180 |
Synapsin I Polyclonal Antibody |
ABP-PAB-22036 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Pan-specific Antibodies
- Brand:
|
I-FABP Polyclonal Antibody |
ABP58874-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132
- Applications tips:
|
Description: A polyclonal antibody for detection of I-FABP from Human, Mouse, Rat. This I-FABP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132 |
I-FABP Polyclonal Antibody |
ABP58874-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132
- Applications tips:
|
Description: A polyclonal antibody for detection of I-FABP from Human, Mouse, Rat. This I-FABP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132 |
I-FABP Polyclonal Antibody |
ABP58874-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132
- Applications tips:
|
Description: A polyclonal antibody for detection of I-FABP from Human, Mouse, Rat. This I-FABP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human I-FABP protein at amino acid sequence of 90-132 |
I?B-? Polyclonal Antibody |
ABP55388-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
- Applications tips:
|
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22 |
I?B-? Polyclonal Antibody |
ABP55388-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
- Applications tips:
|
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22 |
I?B-? Polyclonal Antibody |
ABP55388-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
- Applications tips:
|
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22 |
Neurophysin I Polyclonal Antibody |
ABP55453-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I |
Neurophysin I Polyclonal Antibody |
ABP55453-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I |
Neurophysin I Polyclonal Antibody |
ABP55453-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
- Applications tips:
|
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I |
Collagen I Polyclonal Antibody |
ABP58229-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
- Applications tips:
|
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542 |
Collagen I Polyclonal Antibody |
ABP58229-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
- Applications tips:
|
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542 |