Order Now: brent@sdlifesciences.com
 PRX I Polyclonal Antibody |
|
ABP53186-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I |
PRX I Polyclonal Antibody |
|
ABP57178-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PRX I Polyclonal Antibody |
|
ABP57178-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PRX I Polyclonal Antibody |
|
ABP57178-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PRX I Polyclonal Antibody |
|
ES8177-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
PRX I Polyclonal Antibody |
|
ES8177-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
PRX I Polyclonal Antibody |
|
ES4185-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
PRX I Polyclonal Antibody |
|
ES4185-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
 PRX I Polyclonal Conjugated Antibody |
|
C41828 |
SAB |
100ul |
EUR 397 |
 Anti-PRX I antibody |
|
STJ96820 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to PRX I. |
Anti-PRX I antibody |
|
STJ97366 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to PRX I. |
 PRX Polyclonal Antibody |
|
30158-100ul |
SAB |
100ul |
EUR 252 |
PRX Polyclonal Antibody |
|
30158-50ul |
SAB |
50ul |
EUR 187 |
 PRX Rabbit pAb |
|
A17744-100ul |
Abclonal |
100 ul |
EUR 308 |
PRX Rabbit pAb |
|
A17744-200ul |
Abclonal |
200 ul |
EUR 459 |
PRX Rabbit pAb |
|
A17744-20ul |
Abclonal |
20 ul |
EUR 183 |
PRX Rabbit pAb |
|
A17744-50ul |
Abclonal |
50 ul |
EUR 223 |
 PRX III Polyclonal Antibody |
|
41363-100ul |
SAB |
100ul |
EUR 252 |
PRX III Polyclonal Antibody |
|
41363-50ul |
SAB |
50ul |
EUR 187 |
 PRX Polyclonal Conjugated Antibody |
|
C30158 |
SAB |
100ul |
EUR 397 |
PRX III Polyclonal Antibody |
|
ABP52267-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III |
PRX III Polyclonal Antibody |
|
ABP52267-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III |
PRX III Polyclonal Antibody |
|
ABP52267-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III |
 PRX II Polyclonal Antibody |
|
ABP56362-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II |
PRX II Polyclonal Antibody |
|
ABP56362-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II |
PRX II Polyclonal Antibody |
|
ABP56362-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II |
PRX II Polyclonal Antibody |
|
ES7361-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PRX II Polyclonal Antibody |
|
ES7361-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PRX III Polyclonal Antibody |
|
ES3266-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
PRX III Polyclonal Antibody |
|
ES3266-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
 PRX Antibody |
|
1-CSB-PA018656GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against PRX. Recognizes PRX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 PRX III Polyclonal Conjugated Antibody |
|
C41363 |
SAB |
100ul |
EUR 397 |
 Prx III antibody |
|
70R-21656 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal Prx III antibody |
 Anti-PRX Antibody |
|
A01686 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-PRX antibody |
|
STJ119785 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008] |
) IGF-I Polyclonal Antibody (Rabbit) |
|
PABCa |
GroPep |
1 mg |
EUR 299 |
 PRX siRNA |
|
20-abx904297 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRX siRNA |
|
20-abx930081 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PRX siRNA |
|
20-abx930082 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Human IGF-I Polyclonal Antibody (Rabbit) |
|
PAA2 |
GroPep |
400 µg |
EUR 299 |
 Anti-PRX II antibody |
|
STJ95237 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to PRX II. |
 Anti-PRX III antibody |
|
STJ95238 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to PRX III. |
 Polyclonal Rabbit anti-Troponin I |
|
TnI |
Detroit R&D |
50 uL |
EUR 280 |
 Human Interferon Type I Signaling Primer Library |
|
HIFN-I |
Real Time Primers |
1 set |
EUR 548 |
 Rabbit Anti-Complement Factor I Polyclonal Antibody |
|
CTA-335-100ug |
Creative Biolabs |
100ug |
Ask for price |
|
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P. |
Rabbit Anti-Complement Factor I Polyclonal Antibody |
|
CTA-335-1mg |
Creative Biolabs |
1mg |
Ask for price |
|
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P. |
 PRX cloning plasmid |
|
CSB-CL018833HU-10ug |
Cusabio |
10ug |
EUR 1715 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4386
- Sequence: atggaggccaggagccggagtgccgaggagctgaggcgggcggagttggtggaaattatcgtggagacggaggcgcagaccggggtcagcggcatcaacgtagcgggcggcggcaaagagggaatcttcgttcgggagctgcgcgaggactcacccgccgccaggagcctcagcc
- Show more
|
|
Description: A cloning plasmid for the PRX gene. |
) Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum) |
|
TG2012-2 |
TopoGen |
250 ul |
EUR 380 |
 Polyclonal Antibody) Rabbit Anti Phap I (C-Terminal) Polyclonal Antibody |
|
CPBT-66414RP |
Creative Diagnostics |
0.1 mg |
EUR 663 |
 Rabbit Anti Bovine Collagen I/Iii Polyclonal Antibody |
|
CPBT-67295RB |
Creative Diagnostics |
0.5 ml |
EUR 767 |
 Rabbit Anti Human Collagen I/Iii Polyclonal Antibody |
|
CPBT-67898RH |
Creative Diagnostics |
0.5 ml |
EUR 767 |
 Mouse PRX shRNA Plasmid |
|
20-abx972229 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat PRX shRNA Plasmid |
|
20-abx986471 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PRX shRNA Plasmid |
|
20-abx961655 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 PRX-08066 Maleic acid |
|
A2098-10 |
ApexBio |
10 mg |
EUR 608 |
|
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1]. |
PRX-08066 Maleic acid |
|
A2098-5 |
ApexBio |
5 mg |
EUR 457 |
|
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1]. |
PRX-08066 Maleic acid |
|
A2098-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 893 |
|
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1]. |
 Collagen I Polyclonal Antibody |
|
46888-100ul |
SAB |
100ul |
EUR 252 |
Collagen I Polyclonal Antibody |
|
46888-50ul |
SAB |
50ul |
EUR 187 |
 HXK I Polyclonal Antibody |
|
41049-100ul |
SAB |
100ul |
EUR 252 |
HXK I Polyclonal Antibody |
|
41049-50ul |
SAB |
50ul |
EUR 187 |
 Synapsin I Polyclonal Antibody |
|
41470-100ul |
SAB |
100ul |
EUR 252 |
Synapsin I Polyclonal Antibody |
|
41470-50ul |
SAB |
50ul |
EUR 187 |
 ApoA-I Polyclonal Antibody |
|
41817-100ul |
SAB |
100ul |
EUR 252 |
ApoA-I Polyclonal Antibody |
|
41817-50ul |
SAB |
50ul |
EUR 187 |
 ANG I Polyclonal Antibody |
|
41909-100ul |
SAB |
100ul |
EUR 252 |
ANG I Polyclonal Antibody |
|
41909-50ul |
SAB |
50ul |
EUR 187 |
 I-FABP Polyclonal Antibody |
|
46763-100ul |
SAB |
100ul |
EUR 252 |
I-FABP Polyclonal Antibody |
|
46763-50ul |
SAB |
50ul |
EUR 187 |
ANG I Polyclonal Antibody |
|
46795-100ul |
SAB |
100ul |
EUR 252 |
ANG I Polyclonal Antibody |
|
46795-50ul |
SAB |
50ul |
EUR 187 |
 Annexin I Polyclonal Antibody |
|
40590-100ul |
SAB |
100ul |
EUR 252 |
Annexin I Polyclonal Antibody |
|
40590-50ul |
SAB |
50ul |
EUR 187 |
Annexin I Polyclonal Antibody |
|
40591-100ul |
SAB |
100ul |
EUR 252 |
