POM121 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

POM121 Transmembrane Nucleoporin (POM121) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

POM121 Transmembrane Nucleoporin (POM121) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

POM121 Transmembrane Nucleoporin (POM121) Antibody

abx236636-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

POM121 Antibody

45454-100ul 100ul
EUR 252

POM121 Antibody

45454-50ul 50ul
EUR 187

POM121 Antibody

DF8708 200ul
EUR 304
Description: POM121 Antibody detects endogenous levels of total POM121.

POM121 Antibody

ABD8708 100 ug
EUR 438

Pom121/ Rat Pom121 ELISA Kit

ELI-21714r 96 Tests
EUR 886

Anti-POM121 Antibody

A06856 100ul
EUR 397
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

POM121 Conjugated Antibody

C45454 100ul
EUR 397

anti- POM121 antibody

FNab06636 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: POM121 membrane glycoprotein(rat)
  • Uniprot ID: Q96HA1
  • Gene ID: 9883
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against POM121

Anti-POM121 antibody

PAab06636 100 ug
EUR 355

Anti-POM121 antibody

STJ95184 200 µl
EUR 197
Description: Rabbit polyclonal to POM121.

POM121 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POM121 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POM121 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POM121/POM121B/POM121C Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against POM121/POM121B/POM121C. Recognizes POM121/POM121B/POM121C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

POM121 / POM121B / POM121C Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human POM121 Transmembrane Nucleoporin (POM121) ELISA Kit

abx382368-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

POM121 Blocking Peptide

DF8708-BP 1mg
EUR 195

POM121 Blocking Peptide

  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

POM121 cloning plasmid

CSB-CL846630HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2955
  • Sequence: atggtgtgtagcccagtgactgtgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaacgccccagacccatgtgcaaaggagacagtactgagtgccctcaaagagaaggagaagaaaagga
  • Show more
Description: A cloning plasmid for the POM121 gene.


ELI-16147h 96 Tests
EUR 824

Mouse Pom121 ELISA KIT

ELI-19702m 96 Tests
EUR 865


EF001946 96 Tests
EUR 689

Rat POM121 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human POM121 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse POM121 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody

abx036508-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody

abx030287-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein (POMZP3) Antibody

abx030287-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

POM121 And ZP3 Fusion Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Pom121 ORF Vector (Rat) (pORF)

ORF073803 1.0 ug DNA
EUR 506

POM121 ORF Vector (Human) (pORF)

ORF008045 1.0 ug DNA
EUR 95

Pom121 ORF Vector (Mouse) (pORF)

ORF054481 1.0 ug DNA
EUR 506

Pom121 sgRNA CRISPR Lentivector set (Rat)

K7587501 3 x 1.0 ug
EUR 339

Pom121 sgRNA CRISPR Lentivector set (Mouse)

K3065201 3 x 1.0 ug
EUR 339

POM121 sgRNA CRISPR Lentivector set (Human)

K1685801 3 x 1.0 ug
EUR 339

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7587502 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7587503 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7587504 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3065202 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3065203 1.0 ug DNA
EUR 154

Pom121 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3065204 1.0 ug DNA
EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 1)

K1685802 1.0 ug DNA
EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 2)

K1685803 1.0 ug DNA
EUR 154

POM121 sgRNA CRISPR Lentivector (Human) (Target 3)

K1685804 1.0 ug DNA
EUR 154

POM121 Protein Vector (Rat) (pPB-C-His)

PV295210 500 ng
EUR 1191

POM121 Protein Vector (Rat) (pPB-N-His)

PV295211 500 ng
EUR 1191

POM121 Protein Vector (Rat) (pPM-C-HA)

PV295212 500 ng
EUR 1191

POM121 Protein Vector (Rat) (pPM-C-His)

PV295213 500 ng
EUR 1191

POM121 Protein Vector (Human) (pPB-C-His)

PV032177 500 ng
EUR 329

POM121 Protein Vector (Human) (pPB-N-His)

PV032178 500 ng
EUR 329

POM121 Protein Vector (Human) (pPM-C-HA)

PV032179 500 ng
EUR 329

POM121 Protein Vector (Human) (pPM-C-His)

PV032180 500 ng
EUR 329

POM121 Protein Vector (Mouse) (pPB-C-His)

PV217922 500 ng
EUR 1065

POM121 Protein Vector (Mouse) (pPB-N-His)

PV217923 500 ng
EUR 1065

POM121 Protein Vector (Mouse) (pPM-C-HA)

PV217924 500 ng
EUR 1065

POM121 Protein Vector (Mouse) (pPM-C-His)

PV217925 500 ng
EUR 1065

Pom121 3'UTR Luciferase Stable Cell Line

TU116703 1.0 ml Ask for price

Pom121 3'UTR GFP Stable Cell Line

TU166703 1.0 ml Ask for price

Pom121 3'UTR Luciferase Stable Cell Line

TU216549 1.0 ml Ask for price

Pom121 3'UTR GFP Stable Cell Line

TU266549 1.0 ml Ask for price

POM121 3'UTR GFP Stable Cell Line

TU068448 1.0 ml
EUR 2333

POM121 3'UTR Luciferase Stable Cell Line

TU018448 1.0 ml
EUR 2333

Human POM121- like protein 12, POM121L12 ELISA KIT

ELI-14695h 96 Tests
EUR 824

Human POM121- like protein 2, POM121L2 ELISA KIT

ELI-21792h 96 Tests
EUR 824

Mouse POM121- like protein 2, Pom121l2 ELISA KIT

ELI-35503m 96 Tests
EUR 865

POM121 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV657727 1.0 ug DNA
EUR 1355

POM121 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV657731 1.0 ug DNA
EUR 1355

POM121 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV657732 1.0 ug DNA
EUR 1355

POMZP3 POM121 And ZP3 Fusion Human Recombinant Protein

PROTQ6PJE2 Regular: 20ug
EUR 317
Description: POMZP3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 210 amino acids (1-187) and having a molecular mass of 23.0 kDa.;POMZP3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein