Order Now: brent@sdlifesciences.com
 OXSR1 Polyclonal Antibody |
|
ES8142-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against OXSR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
OXSR1 Polyclonal Antibody |
|
ABP57143-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
- Applications tips:
|
|
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 |
|
OXSR1 Polyclonal Antibody |
|
ABP57143-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
- Applications tips:
|
|
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 |
|
OXSR1 Polyclonal Antibody |
|
ABP57143-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
- Applications tips:
|
|
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 |
 OXSR1 Rabbit pAb |
|
A15126-100ul |
Abclonal |
100 ul |
EUR 308 |
|
OXSR1 Rabbit pAb |
|
A15126-200ul |
Abclonal |
200 ul |
EUR 459 |
|
OXSR1 Rabbit pAb |
|
A15126-20ul |
Abclonal |
20 ul |
EUR 183 |
|
OXSR1 Rabbit pAb |
|
A15126-50ul |
Abclonal |
50 ul |
EUR 223 |
 OXSR1 antibody |
|
70R-50759 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal OXSR1 antibody |
 OXSR1 Antibody |
|
36674-100ul |
SAB |
100ul |
EUR 252 |
|
OXSR1 antibody |
|
10R-5137 |
Fitzgerald |
100 ul |
EUR 726 |
|
Description: Mouse monoclonal OXSR1 antibody |
|
OXSR1 antibody |
|
70R-19075 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal OXSR1 antibody |
|
OXSR1 antibody |
|
70R-13432 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal OXSR1 antibody |
|
OXSR1 Antibody |
|
1-CSB-PA998479 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
|
OXSR1 Antibody |
|
1-CSB-PA220770 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
|
OXSR1 Antibody |
|
1-CSB-PA080105 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000 |
|
OXSR1 Antibody |
|
1-CSB-PA080106 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
|
OXSR1 Antibody |
|
1-CSB-PA017314GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
 OXSR1 Conjugated Antibody |
|
C36674 |
SAB |
100ul |
EUR 397 |
 anti- OXSR1 antibody |
|
FNab06055 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: oxidative-stress responsive 1
- Uniprot ID: O95747
- Gene ID: 9943
- Research Area: Metabolism
|
|
Description: Antibody raised against OXSR1 |
 Antibody) OXSR1 (pT185) Antibody |
|
abx333001-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
 antibody) OXSR1(OSR1) antibody |
|
22738-100ul |
SAB |
100ul |
EUR 390 |
 Anti-OXSR1 antibody |
|
STJ94847 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to OXSR1. |
|
Anti-OXSR1 antibody |
|
STJ117320 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. |
 OXSR1 siRNA |
|
20-abx927518 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
OXSR1 siRNA |
|
20-abx927519 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-OXSR1 |
|
YF-PA16593 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to OXSR1 |
|
anti-OXSR1 |
|
YF-PA16594 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to OXSR1 |
|
anti-OXSR1 |
|
YF-PA25437 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to OXSR1 |
 Antibody) Phospho-OXSR1 (T185) Antibody |
|
1-CSB-PA080104 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against Phospho-OXSR1 (T185). Recognizes Phospho-OXSR1 (T185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
 Antibody) Phospho-OXSR1 (Thr185) Antibody |
|
CSB-PA067482- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
|
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100 |
|
Phospho-OXSR1 (Thr185) Antibody |
|
CSB-PA067482-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
|
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100 |
 OXSR1 cloning plasmid |
|
CSB-CL017314HU-10ug |
Cusabio |
10ug |
EUR 553 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1584
- Sequence: atgtccgaggactcgagcgccctgccctggtccatcaacagggacgattacgagctgcaggaggtgatcgggagtggagcaactgctgtagtccaagcagcttattgtgcccctaaaaaggagaaagtggcaatcaaacggataaaccttgagaaatgtcaaactagcatggatg
- Show more
|
|
Description: A cloning plasmid for the OXSR1 gene. |
 OXSR1 Blocking Peptide |
|
20-abx063634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) anti-OXSR1 (1D10) |
|
LF-MA10396 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) anti-OXSR1 (5D5) |
|
LF-MA10397 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (5E1) |
|
YF-MA17042 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (1C8) |
|
YF-MA17043 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
|
Anti-OXSR1 (1C8) |
|
YF-MA17044 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (2E9) |
|
YF-MA17045 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (1F6) |
|
YF-MA17046 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (3F6) |
|
YF-MA17048 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (4D12) |
|
YF-MA17049 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (1B10) |
|
YF-MA17050 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (4C12) |
|
YF-MA17051 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (2A5) |
|
YF-MA17052 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (6C7) |
|
YF-MA11223 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (4G9) |
|
YF-MA11224 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (3A8) |
|
YF-MA11225 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) Anti-OXSR1 (1B9) |
|
YF-MA11226 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
 Antibody) Oxidative-Stress Responsive 1 (OXSR1) Antibody |
|
20-abx114290 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 OXSR1 Cell ELISA Kit |
|
abx595437-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
 Mouse OXSR1 shRNA Plasmid |
|
20-abx979928 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human OXSR1 shRNA Plasmid |
|
20-abx956685 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) OXSR1 protein (His tag) |
|
80R-3983 |
Fitzgerald |
100 ug |
EUR 349 |
|
Description: Recombinant Human OXSR1 protein |
) anti-OXSR1 (2A2-1A2) |
|
LF-MA10395 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to OXSR1 |
) OXSR1 Recombinant Protein (Human) |
|
RP022333 |
ABM |
100 ug |
Ask for price |
) OXSR1 Recombinant Protein (Rat) |
|
RP219032 |
ABM |
100 ug |
Ask for price |
) OXSR1 Recombinant Protein (Mouse) |
|
RP159734 |
ABM |
100 ug |
Ask for price |
 (M16), Clone: 3A8) Monoclonal OXSR1 Antibody (monoclonal) (M16), Clone: 3A8 |
|
APR17696G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M16). The antibodies are raised in mouse and are from clone 3A8. This antibody is applicable in WB, IHC and IF, E |
 (M18), Clone: 4C12) Monoclonal OXSR1 Antibody (monoclonal) (M18), Clone: 4C12 |
|
APR17697G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M18). The antibodies are raised in mouse and are from clone 4C12. This antibody is applicable in WB and IF, E |
 (M19), Clone: 1B9) Monoclonal OXSR1 Antibody (monoclonal) (M19), Clone: 1B9 |
|
APR17698G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M19). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in WB, IHC and IF, E |
 Antibody) Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
|
20-abx123890 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
|
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
|
abx146245-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
|
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
|
20-abx008374 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
 Antibody) Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
|
20-abx325277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
|
20-abx325602 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
|
abx236055-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
|
20-abx212012 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
|
20-abx213481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) OXSR1 ORF Vector (Human) (pORF) |
|
ORF007445 |
ABM |
1.0 ug DNA |
EUR 95 |
 h OXSR1 inducible lentiviral particles |
|
LVP259 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, OXSR1, is fully sequence verified and matched to NCBI accession ID: NM_005109.2 |
 (pORF)) Oxsr1 ORF Vector (Rat) (pORF) |
|
ORF073012 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Oxsr1 ORF Vector (Mouse) (pORF) |
|
ORF053246 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEH08534)) OXSR1 ELISA Kit (Human) (OKEH08534) |
|
OKEH08534 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
 (M01), Clone: 2A2-1A2) Monoclonal OXSR1 Antibody (monoclonal) (M01), Clone: 2A2-1A2 |
|
APR17695G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A2-1A2. This antibody is applicable in WB and IF, E |
 Antibody) Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody |
|
33219-05111 |
AssayPro |
150 ug |
EUR 261 |
 OXSR1 Colorimetric Cell-Based ELISA Kit |
|
EKC1416 |
BosterBio |
100ul |
EUR 572 |
) OXSR1 sgRNA CRISPR Lentivector set (Human) |
|
K1580801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Oxsr1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3459001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Oxsr1 sgRNA CRISPR Lentivector set (Rat) |
|
K6568101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) OXSR1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1580802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) OXSR1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1580803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) OXSR1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1580804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3459002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3459003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3459004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6568102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6568103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6568104 |
ABM |
1.0 ug DNA |
EUR 154 |
 Recombinant Human OXSR1 Protein, His, E.coli-1mg |
|
QP12944-1mg |
EnQuireBio |
1mg |
EUR 2757 |
 Recombinant Human OXSR1 Protein, His, E.coli-20ug |
|
QP12944-20ug |
EnQuireBio |
20ug |
EUR 201 |
 Recombinant Human OXSR1 Protein, His, E.coli-5ug |
|
QP12944-5ug |
EnQuireBio |
5ug |
EUR 155 |
 (pPB-C-His)) OXSR1 Protein Vector (Human) (pPB-C-His) |
|
PV029777 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) OXSR1 Protein Vector (Human) (pPB-N-His) |
|
PV029778 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) OXSR1 Protein Vector (Human) (pPM-C-HA) |
|
PV029779 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) OXSR1 Protein Vector (Human) (pPM-C-His) |
|
PV029780 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) OXSR1 Protein Vector (Mouse) (pPB-C-His) |
|
PV212982 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) OXSR1 Protein Vector (Mouse) (pPB-N-His) |
|
PV212983 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) OXSR1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV212984 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) OXSR1 Protein Vector (Mouse) (pPM-C-His) |
|
PV212985 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) OXSR1 Protein Vector (Rat) (pPB-C-His) |
|
PV292046 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) OXSR1 Protein Vector (Rat) (pPB-N-His) |
|
PV292047 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) OXSR1 Protein Vector (Rat) (pPM-C-HA) |
|
PV292048 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) OXSR1 Protein Vector (Rat) (pPM-C-His) |
|
PV292049 |
ABM |
500 ng |
EUR 603 |
 Oxsr1 3'UTR GFP Stable Cell Line |
|
TU165803 |
ABM |
1.0 ml |
Ask for price |
 OXSR1 3'UTR Luciferase Stable Cell Line |
|
TU017242 |
ABM |
1.0 ml |
EUR 1521 |
 Oxsr1 3'UTR Luciferase Stable Cell Line |
|
TU115803 |
ABM |
1.0 ml |
Ask for price |
 OXSR1 3'UTR GFP Stable Cell Line |
|
TU067242 |
ABM |
1.0 ml |
EUR 1521 |
|
Oxsr1 3'UTR GFP Stable Cell Line |
|
TU265717 |
ABM |
1.0 ml |
Ask for price |
|
Oxsr1 3'UTR Luciferase Stable Cell Line |
|
TU215717 |
ABM |
1.0 ml |
Ask for price |
) OXSR1 Colorimetric Cell-Based ELISA Kit (OKAG00926) |
|
OKAG00926 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
|
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity: |
 Antibody) Serine/threonine-protein kinase OSR1 Phospho-Thr185 (OXSR1 pT185) Antibody |
|
20-abx325747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin Conjugate)) Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody (Biotin Conjugate) |
|
33219-05121 |
AssayPro |
150 ug |
EUR 369 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
|
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
OXSR1 ELISA KIT|Human