Order Now: brent@sdlifesciences.com
OXSR1 Polyclonal Antibody |
ABP57143-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
- Applications tips:
|
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 |
OXSR1 Polyclonal Antibody |
ABP57143-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330
- Applications tips:
|
Description: A polyclonal antibody for detection of OXSR1 from Human, Mouse. This OXSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human OXSR1 at AA range: 250-330 |
OXSR1 Polyclonal Antibody |
ES8142-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against OXSR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OXSR1 Polyclonal Antibody |
ES8142-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against OXSR1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OXSR1 Rabbit pAb |
A15126-100ul |
Abclonal |
100 ul |
EUR 308 |
OXSR1 Rabbit pAb |
A15126-200ul |
Abclonal |
200 ul |
EUR 459 |
OXSR1 Rabbit pAb |
A15126-20ul |
Abclonal |
20 ul |
EUR 183 |
OXSR1 Rabbit pAb |
A15126-50ul |
Abclonal |
50 ul |
EUR 223 |
OXSR1 antibody |
70R-19075 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal OXSR1 antibody |
OXSR1 antibody |
70R-13432 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal OXSR1 antibody |
OXSR1 Antibody |
36674-100ul |
SAB |
100ul |
EUR 252 |
OXSR1 antibody |
10R-5137 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal OXSR1 antibody |
OXSR1 Antibody |
1-CSB-PA080105 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000 |
OXSR1 Antibody |
1-CSB-PA080106 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
OXSR1 Antibody |
1-CSB-PA998479 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
OXSR1 Antibody |
1-CSB-PA017314GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
OXSR1 Antibody |
1-CSB-PA220770 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against OXSR1. Recognizes OXSR1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
OXSR1 antibody |
70R-50759 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal OXSR1 antibody |
OXSR1(OSR1) antibody |
22738-100ul |
SAB |
100ul |
EUR 390 |
OXSR1 Conjugated Antibody |
C36674 |
SAB |
100ul |
EUR 397 |
OXSR1 (pT185) Antibody |
abx333001-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
anti- OXSR1 antibody |
FNab06055 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: oxidative-stress responsive 1
- Uniprot ID: O95747
- Gene ID: 9943
- Research Area: Metabolism
|
Description: Antibody raised against OXSR1 |
Anti-OXSR1 antibody |
STJ117320 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. |
Anti-OXSR1 antibody |
STJ94847 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to OXSR1. |
OXSR1 siRNA |
20-abx927518 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OXSR1 siRNA |
20-abx927519 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-OXSR1 |
YF-PA16593 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to OXSR1 |
anti-OXSR1 |
YF-PA16594 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to OXSR1 |
anti-OXSR1 |
YF-PA25437 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to OXSR1 |
Phospho-OXSR1 (Thr185) Antibody |
CSB-PA067482- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100 |
Phospho-OXSR1 (Thr185) Antibody |
CSB-PA067482-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-OXSR1 (Thr185). Recognizes Phospho-OXSR1 (Thr185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100 |
Phospho-OXSR1 (T185) Antibody |
1-CSB-PA080104 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-OXSR1 (T185). Recognizes Phospho-OXSR1 (T185) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
OXSR1 Blocking Peptide |
20-abx063634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OXSR1 cloning plasmid |
CSB-CL017314HU-10ug |
Cusabio |
10ug |
EUR 553 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1584
- Sequence: atgtccgaggactcgagcgccctgccctggtccatcaacagggacgattacgagctgcaggaggtgatcgggagtggagcaactgctgtagtccaagcagcttattgtgcccctaaaaaggagaaagtggcaatcaaacggataaaccttgagaaatgtcaaactagcatggatg
- Show more
|
Description: A cloning plasmid for the OXSR1 gene. |
anti-OXSR1 (1D10) |
LF-MA10396 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
anti-OXSR1 (5D5) |
LF-MA10397 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (6C7) |
YF-MA11223 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (4G9) |
YF-MA11224 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (3A8) |
YF-MA11225 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (1B9) |
YF-MA11226 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (5E1) |
YF-MA17042 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (1C8) |
YF-MA17043 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (1C8) |
YF-MA17044 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (2E9) |
YF-MA17045 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (1F6) |
YF-MA17046 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (3F6) |
YF-MA17048 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (4D12) |
YF-MA17049 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (1B10) |
YF-MA17050 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (4C12) |
YF-MA17051 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Anti-OXSR1 (2A5) |
YF-MA17052 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
Oxidative-Stress Responsive 1 (OXSR1) Antibody |
20-abx114290 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OXSR1 protein (His tag) |
80R-3983 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Recombinant Human OXSR1 protein |
OXSR1 Cell ELISA Kit |
abx595437-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Human OXSR1 shRNA Plasmid |
20-abx956685 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse OXSR1 shRNA Plasmid |
20-abx979928 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
anti-OXSR1 (2A2-1A2) |
LF-MA10395 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to OXSR1 |
OXSR1 Recombinant Protein (Human) |
RP022333 |
ABM |
100 ug |
Ask for price |
OXSR1 Recombinant Protein (Mouse) |
RP159734 |
ABM |
100 ug |
Ask for price |
OXSR1 Recombinant Protein (Rat) |
RP219032 |
ABM |
100 ug |
Ask for price |
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
20-abx008374 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
20-abx212012 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
20-abx213481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
20-abx123890 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
abx146245-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Monoclonal OXSR1 Antibody (monoclonal) (M16), Clone: 3A8 |
APR17696G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M16). The antibodies are raised in mouse and are from clone 3A8. This antibody is applicable in WB, IHC and IF, E |
Monoclonal OXSR1 Antibody (monoclonal) (M18), Clone: 4C12 |
APR17697G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M18). The antibodies are raised in mouse and are from clone 4C12. This antibody is applicable in WB and IF, E |
Monoclonal OXSR1 Antibody (monoclonal) (M19), Clone: 1B9 |
APR17698G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M19). The antibodies are raised in mouse and are from clone 1B9. This antibody is applicable in WB, IHC and IF, E |
Serine/threonine-Protein Kinase OSR1 (OXSR1) Antibody |
abx236055-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
20-abx325277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-protein kinase OSR1 (OXSR1) Antibody |
20-abx325602 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Oxsr1 ORF Vector (Rat) (pORF) |
ORF073012 |
ABM |
1.0 ug DNA |
EUR 506 |
h OXSR1 inducible lentiviral particles |
LVP259 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, OXSR1, is fully sequence verified and matched to NCBI accession ID: NM_005109.2 |
OXSR1 ORF Vector (Human) (pORF) |
ORF007445 |
ABM |
1.0 ug DNA |
EUR 95 |
Oxsr1 ORF Vector (Mouse) (pORF) |
ORF053246 |
ABM |
1.0 ug DNA |
EUR 506 |
OXSR1 ELISA Kit (Human) (OKEH08534) |
OKEH08534 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody |
33219-05111 |
AssayPro |
150 ug |
EUR 261 |
Monoclonal OXSR1 Antibody (monoclonal) (M01), Clone: 2A2-1A2 |
APR17695G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human OXSR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A2-1A2. This antibody is applicable in WB and IF, E |
OXSR1 Colorimetric Cell-Based ELISA Kit |
EKC1416 |
BosterBio |
100ul |
EUR 572 |
Oxsr1 sgRNA CRISPR Lentivector set (Rat) |
K6568101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Oxsr1 sgRNA CRISPR Lentivector set (Mouse) |
K3459001 |
ABM |
3 x 1.0 ug |
EUR 339 |
OXSR1 sgRNA CRISPR Lentivector set (Human) |
K1580801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6568102 |
ABM |
1.0 ug DNA |
EUR 154 |
Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6568103 |
ABM |
1.0 ug DNA |
EUR 154 |
Oxsr1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6568104 |
ABM |
1.0 ug DNA |
EUR 154 |
Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3459002 |
ABM |
1.0 ug DNA |
EUR 154 |
Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3459003 |
ABM |
1.0 ug DNA |
EUR 154 |
Oxsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3459004 |
ABM |
1.0 ug DNA |
EUR 154 |
OXSR1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1580802 |
ABM |
1.0 ug DNA |
EUR 154 |
OXSR1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1580803 |
ABM |
1.0 ug DNA |
EUR 154 |
OXSR1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1580804 |
ABM |
1.0 ug DNA |
EUR 154 |
OXSR1 Protein Vector (Rat) (pPB-C-His) |
PV292046 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Rat) (pPB-N-His) |
PV292047 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Rat) (pPM-C-HA) |
PV292048 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Rat) (pPM-C-His) |
PV292049 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Mouse) (pPB-C-His) |
PV212982 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Mouse) (pPB-N-His) |
PV212983 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Mouse) (pPM-C-HA) |
PV212984 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Mouse) (pPM-C-His) |
PV212985 |
ABM |
500 ng |
EUR 603 |
OXSR1 Protein Vector (Human) (pPB-C-His) |
PV029777 |
ABM |
500 ng |
EUR 329 |
OXSR1 Protein Vector (Human) (pPB-N-His) |
PV029778 |
ABM |
500 ng |
EUR 329 |
OXSR1 Protein Vector (Human) (pPM-C-HA) |
PV029779 |
ABM |
500 ng |
EUR 329 |
OXSR1 Protein Vector (Human) (pPM-C-His) |
PV029780 |
ABM |
500 ng |
EUR 329 |
Recombinant Human OXSR1 Protein, His, E.coli-1mg |
QP12944-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human OXSR1 Protein, His, E.coli-20ug |
QP12944-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human OXSR1 Protein, His, E.coli-5ug |
QP12944-5ug |
EnQuireBio |
5ug |
EUR 155 |
Oxsr1 3'UTR Luciferase Stable Cell Line |
TU115803 |
ABM |
1.0 ml |
Ask for price |
Oxsr1 3'UTR GFP Stable Cell Line |
TU165803 |
ABM |
1.0 ml |
Ask for price |
Oxsr1 3'UTR GFP Stable Cell Line |
TU265717 |
ABM |
1.0 ml |
Ask for price |
Oxsr1 3'UTR Luciferase Stable Cell Line |
TU215717 |
ABM |
1.0 ml |
Ask for price |
OXSR1 3'UTR GFP Stable Cell Line |
TU067242 |
ABM |
1.0 ml |
EUR 1521 |
OXSR1 3'UTR Luciferase Stable Cell Line |
TU017242 |
ABM |
1.0 ml |
EUR 1521 |
OXSR1 Colorimetric Cell-Based ELISA Kit (OKAG00926) |
OKAG00926 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
Human Oxidative Stress-Responsive 1 Protein (OXSR1) Antibody (Biotin Conjugate) |
33219-05121 |
AssayPro |
150 ug |
EUR 369 |
Serine/threonine-protein kinase OSR1 Phospho-Thr185 (OXSR1 pT185) Antibody |
20-abx325747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |