Order Now: brent@sdlifesciences.com
NUP93 Polyclonal Antibody |
30548-100ul |
SAB |
100ul |
EUR 252 |
NUP93 Polyclonal Antibody |
30548-50ul |
SAB |
50ul |
EUR 187 |
NUP93 Rabbit pAb |
A4333-100ul |
Abclonal |
100 ul |
EUR 308 |
NUP93 Rabbit pAb |
A4333-200ul |
Abclonal |
200 ul |
EUR 459 |
NUP93 Rabbit pAb |
A4333-20ul |
Abclonal |
20 ul |
EUR 183 |
NUP93 Rabbit pAb |
A4333-50ul |
Abclonal |
50 ul |
EUR 223 |
NUP93 Polyclonal Conjugated Antibody |
C30548 |
SAB |
100ul |
EUR 397 |
NUP93 antibody |
10R-1445 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal NUP93 antibody |
NUP93 antibody |
70R-19008 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NUP93 antibody |
NUP93 Antibody |
DF4252 |
Affbiotech |
200ul |
EUR 304 |
Description: NUP93 Antibody detects endogenous levels of total NUP93. |
NUP93 Antibody |
1-CSB-PA822683LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
NUP93 Antibody |
1-CSB-PA080050 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
NUP93 Antibody |
1-CSB-PA016208GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal NUP93 Antibody (C-Term) |
APR17625G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal NUP93 Antibody (N-Term) |
APR17626G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (N-Term). This antibody is tested and proven to work in the following applications: |
anti- NUP93 antibody |
FNab05931 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: nucleoporin 93kDa
- Uniprot ID: Q8N1F7
- Gene ID: 9688
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against NUP93 |
Anti-NUP93 Antibody |
A07090 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Anti-Nup93 antibody |
STJ94577 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Nup93. |
Anti-NUP93 antibody |
STJ24852 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. |
NUP93 siRNA |
20-abx903712 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUP93 siRNA |
20-abx926649 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUP93 siRNA |
20-abx926650 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody |
20-abx003224 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody |
20-abx327868 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody |
20-abx334363 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody |
abx235931-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
NUP93 Antibody, HRP conjugated |
1-CSB-PA822683LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NUP93 Antibody, FITC conjugated |
1-CSB-PA822683LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NUP93 Antibody, Biotin conjugated |
1-CSB-PA822683LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NUP93 Blocking Peptide |
DF4252-BP |
Affbiotech |
1mg |
EUR 195 |
NUP93 cloning plasmid |
CSB-CL822683HU-10ug |
Cusabio |
10ug |
EUR 798 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2460
- Sequence: atggatactgaggggtttggtgagctccttcagcaagctgaacagcttgctgctgagactgagggcatctcagagcttccccatgtggaacggaacttacaggagatccagcaggcgggagagcgcctgcgttcccgtaccctaacacgcacgtcccaggagacggcagatgtca
- Show more
|
Description: A cloning plasmid for the NUP93 gene. |
Nucleoporin 93 kDa (NUP93) Antibody |
20-abx114232 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody (HRP) |
20-abx336847 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody (FITC) |
20-abx336848 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nucleoporin 93 (NUP93) Antibody (Biotin) |
20-abx336849 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Nuclear pore complex protein Nup93, NUP93 ELISA KIT |
ELI-36781h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Nuclear pore complex protein Nup93, NUP93 ELISA KIT |
ELI-44229b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Nuclear pore complex protein Nup93, Nup93 ELISA KIT |
ELI-44561m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse NUP93 shRNA Plasmid |
20-abx977524 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NUP93 shRNA Plasmid |
20-abx988529 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NUP93 shRNA Plasmid |
20-abx956460 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NUP93 Recombinant Protein (Human) |
RP021943 |
ABM |
100 ug |
Ask for price |
NUP93 Recombinant Protein (Rat) |
RP214877 |
ABM |
100 ug |
Ask for price |
NUP93 Recombinant Protein (Mouse) |
RP155525 |
ABM |
100 ug |
Ask for price |
NUP93 ORF Vector (Human) (pORF) |
ORF007315 |
ABM |
1.0 ug DNA |
EUR 95 |
Nup93 ORF Vector (Rat) (pORF) |
ORF071627 |
ABM |
1.0 ug DNA |
EUR 506 |
Nup93 ORF Vector (Mouse) (pORF) |
ORF051843 |
ABM |
1.0 ug DNA |
EUR 506 |
NUP93 sgRNA CRISPR Lentivector set (Human) |
K1468601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nup93 sgRNA CRISPR Lentivector set (Mouse) |
K4879401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nup93 sgRNA CRISPR Lentivector set (Rat) |
K6522901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Nucleoporin 93 kDa (NUP93) ELISA Kit |
abx381937-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NUP93 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1468602 |
ABM |
1.0 ug DNA |
EUR 154 |
NUP93 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1468603 |
ABM |
1.0 ug DNA |
EUR 154 |
NUP93 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1468604 |
ABM |
1.0 ug DNA |
EUR 154 |
Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4879402 |
ABM |
1.0 ug DNA |
EUR 154 |
Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4879403 |
ABM |
1.0 ug DNA |
EUR 154 |
Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4879404 |
ABM |
1.0 ug DNA |
EUR 154 |
Nup93 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6522902 |
ABM |
1.0 ug DNA |
EUR 154 |
Nup93 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6522903 |
ABM |
1.0 ug DNA |
EUR 154 |
Nup93 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6522904 |
ABM |
1.0 ug DNA |
EUR 154 |
NUP93 Protein Vector (Human) (pPB-C-His) |
PV029257 |
ABM |
500 ng |
EUR 329 |
NUP93 Protein Vector (Human) (pPB-N-His) |
PV029258 |
ABM |
500 ng |
EUR 329 |
NUP93 Protein Vector (Human) (pPM-C-HA) |
PV029259 |
ABM |
500 ng |
EUR 329 |
NUP93 Protein Vector (Human) (pPM-C-His) |
PV029260 |
ABM |
500 ng |
EUR 329 |
NUP93 Protein Vector (Mouse) (pPB-C-His) |
PV207370 |
ABM |
500 ng |
EUR 1065 |
NUP93 Protein Vector (Mouse) (pPB-N-His) |
PV207371 |
ABM |
500 ng |
EUR 1065 |
NUP93 Protein Vector (Mouse) (pPM-C-HA) |
PV207372 |
ABM |
500 ng |
EUR 1065 |
NUP93 Protein Vector (Mouse) (pPM-C-His) |
PV207373 |
ABM |
500 ng |
EUR 1065 |
NUP93 Protein Vector (Rat) (pPB-C-His) |
PV286506 |
ABM |
500 ng |
EUR 1166 |
NUP93 Protein Vector (Rat) (pPB-N-His) |
PV286507 |
ABM |
500 ng |
EUR 1166 |
NUP93 Protein Vector (Rat) (pPM-C-HA) |
PV286508 |
ABM |
500 ng |
EUR 1166 |
NUP93 Protein Vector (Rat) (pPM-C-His) |
PV286509 |
ABM |
500 ng |
EUR 1166 |
Nup93 3'UTR GFP Stable Cell Line |
TU164448 |
ABM |
1.0 ml |
Ask for price |
NUP93 3'UTR Luciferase Stable Cell Line |
TU016107 |
ABM |
1.0 ml |
EUR 1394 |
Nup93 3'UTR Luciferase Stable Cell Line |
TU114448 |
ABM |
1.0 ml |
Ask for price |
NUP93 3'UTR GFP Stable Cell Line |
TU066107 |
ABM |
1.0 ml |
EUR 1394 |
Nup93 3'UTR GFP Stable Cell Line |
TU264309 |
ABM |
1.0 ml |
Ask for price |
Nup93 3'UTR Luciferase Stable Cell Line |
TU214309 |
ABM |
1.0 ml |
Ask for price |
NUP93 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV661669 |
ABM |
1.0 ug DNA |
EUR 1355 |
NUP93 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV661673 |
ABM |
1.0 ug DNA |
EUR 1355 |
NUP93 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV661674 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |