Nup93 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

NUP93 Polyclonal Antibody
30548-100ul	SAB	100ul	EUR 252

NUP93 Polyclonal Antibody
30548-50ul	SAB	50ul	EUR 187

NUP93 Rabbit pAb
A4333-100ul	Abclonal	100 ul	EUR 308

NUP93 Rabbit pAb
A4333-200ul	Abclonal	200 ul	EUR 459

NUP93 Rabbit pAb
A4333-20ul	Abclonal	20 ul	EUR 183

NUP93 Rabbit pAb
A4333-50ul	Abclonal	50 ul	EUR 223

NUP93 Polyclonal Conjugated Antibody
C30548	SAB	100ul	EUR 397

NUP93 Antibody
ABD4252	Lifescience Market	100 ug	EUR 438

NUP93 antibody
10R-1445	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal NUP93 antibody

NUP93 antibody
70R-19008	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NUP93 antibody

NUP93 Antibody
DF4252	Affbiotech	200ul	EUR 304
Description: NUP93 Antibody detects endogenous levels of total NUP93.

NUP93 Antibody
1-CSB-PA822683LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

NUP93 Antibody
1-CSB-PA080050	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NUP93 Antibody
1-CSB-PA016208GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal NUP93 Antibody (C-Term)
APR17625G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal NUP93 Antibody (N-Term)
APR17626G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (N-Term). This antibody is tested and proven to work in the following applications:

Nup93/ Rat Nup93 ELISA Kit
ELI-22433r	Lifescience Market	96 Tests	EUR 886

anti- NUP93 antibody
FNab05931	FN Test	100µg	EUR 548.75
Immunogen: nucleoporin 93kDa Uniprot ID: Q8N1F7 Gene ID: 9688 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP93

Anti-NUP93 Antibody
A07090	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-NUP93 antibody
PAab05931	Lifescience Market	100 ug	EUR 386

Anti-Nup93 antibody
STJ94577	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Nup93.

Anti-NUP93 antibody
STJ24852	St John's Laboratory	100 µl	EUR 277
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms.

NUP93 siRNA
20-abx903712	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP93 siRNA
20-abx926649	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP93 siRNA
20-abx926650	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody
20-abx003224	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody
20-abx327868	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody
20-abx334363	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody
abx235931-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

NUP93 Antibody, HRP conjugated
1-CSB-PA822683LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP93 Antibody, FITC conjugated
1-CSB-PA822683LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP93 Antibody, Biotin conjugated
1-CSB-PA822683LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUP93 Blocking Peptide
DF4252-BP	Affbiotech	1mg	EUR 195

NUP93 cloning plasmid
CSB-CL822683HU-10ug	Cusabio	10ug	EUR 798
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2460 Sequence: atggatactgaggggtttggtgagctccttcagcaagctgaacagcttgctgctgagactgagggcatctcagagcttccccatgtggaacggaacttacaggagatccagcaggcgggagagcgcctgcgttcccgtaccctaacacgcacgtcccaggagacggcagatgtca Show more
Description: A cloning plasmid for the NUP93 gene.

Nucleoporin 93 kDa (NUP93) Antibody
20-abx114232	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (HRP)
20-abx336847	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (FITC)
20-abx336848	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (Biotin)
20-abx336849	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Nuclear pore complex protein Nup93, NUP93 ELISA KIT
ELI-36781h	Lifescience Market	96 Tests	EUR 824

Bovine Nuclear pore complex protein Nup93, NUP93 ELISA KIT
ELI-44229b	Lifescience Market	96 Tests	EUR 928

Mouse Nuclear pore complex protein Nup93, Nup93 ELISA KIT
ELI-44561m	Lifescience Market	96 Tests	EUR 865

Mouse NUP93 shRNA Plasmid
20-abx977524	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NUP93 shRNA Plasmid
20-abx988529	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NUP93 ELISA KIT|Human
EF001396	Lifescience Market	96 Tests	EUR 689

Human NUP93 shRNA Plasmid
20-abx956460	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NUP93 Recombinant Protein (Human)
RP021943	ABM	100 ug	Ask for price

NUP93 Recombinant Protein (Rat)
RP214877	ABM	100 ug	Ask for price

pEGFP-C1X-Nup93-mut
PVT17940	Lifescience Market	2 ug	EUR 258

NUP93 Recombinant Protein (Mouse)
RP155525	ABM	100 ug	Ask for price

NUP93 ORF Vector (Human) (pORF)
ORF007315	ABM	1.0 ug DNA	EUR 95

Nup93 ORF Vector (Rat) (pORF)
ORF071627	ABM	1.0 ug DNA	EUR 506

Nup93 ORF Vector (Mouse) (pORF)
ORF051843	ABM	1.0 ug DNA	EUR 506

NUP93 sgRNA CRISPR Lentivector set (Human)
K1468601	ABM	3 x 1.0 ug	EUR 339

Nup93 sgRNA CRISPR Lentivector set (Mouse)
K4879401	ABM	3 x 1.0 ug	EUR 339

Nup93 sgRNA CRISPR Lentivector set (Rat)
K6522901	ABM	3 x 1.0 ug	EUR 339

Human Nucleoporin 93kDa(NUP93)ELISA Kit
QY-E05178	Qayee Biotechnology	96T	EUR 361

Human Nucleoporin 93 kDa (NUP93) ELISA Kit
abx381937-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NUP93 sgRNA CRISPR Lentivector (Human) (Target 1)
K1468602	ABM	1.0 ug DNA	EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 2)
K1468603	ABM	1.0 ug DNA	EUR 154

NUP93 sgRNA CRISPR Lentivector (Human) (Target 3)
K1468604	ABM	1.0 ug DNA	EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4879402	ABM	1.0 ug DNA	EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4879403	ABM	1.0 ug DNA	EUR 154

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4879404	ABM	1.0 ug DNA	EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6522902	ABM	1.0 ug DNA	EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6522903	ABM	1.0 ug DNA	EUR 154

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6522904	ABM	1.0 ug DNA	EUR 154

NUP93 Protein Vector (Human) (pPB-C-His)
PV029257	ABM	500 ng	EUR 329

NUP93 Protein Vector (Human) (pPB-N-His)
PV029258	ABM	500 ng	EUR 329

NUP93 Protein Vector (Human) (pPM-C-HA)
PV029259	ABM	500 ng	EUR 329

NUP93 Protein Vector (Human) (pPM-C-His)
PV029260	ABM	500 ng	EUR 329

NUP93 Protein Vector (Mouse) (pPB-C-His)
PV207370	ABM	500 ng	EUR 1065

NUP93 Protein Vector (Mouse) (pPB-N-His)
PV207371	ABM	500 ng	EUR 1065

NUP93 Protein Vector (Mouse) (pPM-C-HA)
PV207372	ABM	500 ng	EUR 1065

NUP93 Protein Vector (Mouse) (pPM-C-His)
PV207373	ABM	500 ng	EUR 1065

NUP93 Protein Vector (Rat) (pPB-C-His)
PV286506	ABM	500 ng	EUR 1166

NUP93 Protein Vector (Rat) (pPB-N-His)
PV286507	ABM	500 ng	EUR 1166

NUP93 Protein Vector (Rat) (pPM-C-HA)
PV286508	ABM	500 ng	EUR 1166

NUP93 Protein Vector (Rat) (pPM-C-His)
PV286509	ABM	500 ng	EUR 1166

Nup93 3'UTR GFP Stable Cell Line
TU164448	ABM	1.0 ml	Ask for price

NUP93 3'UTR Luciferase Stable Cell Line
TU016107	ABM	1.0 ml	EUR 1394

Nup93 3'UTR Luciferase Stable Cell Line
TU114448	ABM	1.0 ml	Ask for price

NUP93 3'UTR GFP Stable Cell Line
TU066107	ABM	1.0 ml	EUR 1394

Nup93 3'UTR GFP Stable Cell Line
TU264309	ABM	1.0 ml	Ask for price

Nup93 3'UTR Luciferase Stable Cell Line
TU214309	ABM	1.0 ml	Ask for price

NUP93 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV661669	ABM	1.0 ug DNA	EUR 1355

NUP93 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV661673	ABM	1.0 ug DNA	EUR 1355

NUP93 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV661674	ABM	1.0 ug DNA	EUR 1355

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC