NLRX1 Rabbit Polyclonal Antibody

Order Now:

NLRX1 Polyclonal Antibody

ES8520-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NLRX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NLRX1 Polyclonal Antibody

ES8520-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NLRX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

NLRX1 Rabbit pAb

A4976-100ul 100 ul
EUR 308

NLRX1 Rabbit pAb

A4976-200ul 200 ul
EUR 459

NLRX1 Rabbit pAb

A4976-20ul 20 ul
EUR 183

NLRX1 Rabbit pAb

A4976-50ul 50 ul
EUR 223

NLRX1 Polyclonal Conjugated Antibody

C30284 100ul
EUR 397

NLRX1 Polyclonal Conjugated Antibody

C46745 100ul
EUR 397

NLRX1 antibody

70R-18898 50 ul
EUR 435
Description: Rabbit polyclonal NLRX1 antibody

NLRX1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

NLRX1 Antibody

DF12124 200ul
EUR 304
Description: NLRX1 antibody detects endogenous levels of NLRX1.

NLRX1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NLRX1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

[KO Validated] NLRX1 Polyclonal Antibody

30284-100ul 100ul
EUR 252

[KO Validated] NLRX1 Polyclonal Antibody

30284-50ul 50ul
EUR 187

Polyclonal NLRX1 Antibody (aa580-630)

APR02984G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 (aa580-630). This antibody is tested and proven to work in the following applications:

Polyclonal NLRX1 / NOD9 Antibody (internal region)

APG00658G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NLRX1 / NOD9 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal NLRX1 Antibody - C-terminal region

APR01607G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 - C-terminal region. This antibody is tested and proven to work in the following applications:

[KO Validated] NLRX1 Rabbit pAb

A18065-100ul 100 ul
EUR 410

[KO Validated] NLRX1 Rabbit pAb

A18065-200ul 200 ul
EUR 571

[KO Validated] NLRX1 Rabbit pAb

A18065-20ul 20 ul
EUR 221

[KO Validated] NLRX1 Rabbit pAb

A18065-50ul 50 ul
EUR 287

anti- NLRX1 antibody

FNab05759 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: NLR family member X1
  • Uniprot ID: Q86UT6
  • Gene ID: 79671
  • Research Area: Immunology
Description: Antibody raised against NLRX1

Anti-NLRX1 antibody

PAab05759 100 ug
EUR 355

Anti-NLRX1 antibody

STJ11100038 100 µl
EUR 413
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene.

Anti-NLRX1 antibody

STJ116270 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene.

Anti-NLRX1 antibody

STJ98633 200 µl
EUR 197
Description: Rabbit polyclonal to NLRX1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-NLRX1/Nod9 Antibody

A04980-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NLRX1 Antibody (NLRX1) detection.tested for IHC, WB in Human, Mouse, Rat.

NLRX1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLRX1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLRX1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-NLRX1 / NOD9 antibody

STJ72177 100 µg
EUR 359

NLRX1 Blocking Peptide

DF12124-BP 1mg
EUR 195

NLRX1 cloning plasmid

CSB-CL015878HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2079
  • Sequence: atggctgctgctgggtcccacctcctctttgtgctccatggcttagagcatctcaacctcgacttccggctggcaggcacgggactttgtagtgacccggaggaaccgcaggaaccagctgctatcatcgtcaacctgctgcgcaaatacatgctgcctcaggccagcattctgg
  • Show more
Description: A cloning plasmid for the NLRX1 gene.


PVT14370 2 ug
EUR 495


EF001257 96 Tests
EUR 689

Rat NLRX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NLRX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NLRX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NLR Family Member X1 (NLRX1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nlr Family Member X1 (NLRX1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NLR Family Member X1 (NLRX1) Antibody

abx146311-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NLR Family Member X1 (NLRX1) Antibody

abx235759-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NLR Family Member X1 (NLRX1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NLR Family Member X1 (NLRX1) Antibody

abx430572-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

NLR Family Member X1 (NLRX1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NLR Family Member X1 (NLRX1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NLR Family Member X1 (NLRX1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NLR Family Member X1 (NLRX1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nlrx1 ORF Vector (Rat) (pORF)

ORF071363 1.0 ug DNA
EUR 506

NLRX1 ORF Vector (Human) (pORF)

ORF007111 1.0 ug DNA
EUR 95

Nlrx1 ORF Vector (Mouse) (pORF)

ORF051459 1.0 ug DNA
EUR 506

Nlrx1 ORF Vector (Mouse) (pORF)

ORF051460 1.0 ug DNA
EUR 506

Nlrx1 ORF Vector (Mouse) (pORF)

ORF051461 1.0 ug DNA
EUR 506

NLRX1 ELISA Kit (Human) (OKCA01393)

OKCA01393 96 Wells
EUR 846
Description: Description of target: Participates in antiviral signaling. Acts as a negative regulator of MAVS-mediated antiviral responses, through the inhibition of the virus-induced RLH (RIG-like helicase)-MAVS interaction (PubMed:18200010). Has no inhibitory function on NF-Kappa-B and type 1 interferon signaling pathways, but enhances NF-Kappa-B and JUN N-terminal kinase dependent signaling through the production of reactive oxygen species (PubMed:18219313).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL

Nlrx1 sgRNA CRISPR Lentivector set (Rat)

K6673301 3 x 1.0 ug
EUR 339

Nlrx1 sgRNA CRISPR Lentivector set (Mouse)

K4382001 3 x 1.0 ug
EUR 339

NLRX1 sgRNA CRISPR Lentivector set (Human)

K1435001 3 x 1.0 ug
EUR 339

Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6673302 1.0 ug DNA
EUR 154

Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6673303 1.0 ug DNA
EUR 154

Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6673304 1.0 ug DNA
EUR 154

Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4382002 1.0 ug DNA
EUR 154

Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4382003 1.0 ug DNA
EUR 154

Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4382004 1.0 ug DNA
EUR 154

NLRX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1435002 1.0 ug DNA
EUR 154

NLRX1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1435003 1.0 ug DNA
EUR 154

NLRX1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1435004 1.0 ug DNA
EUR 154

NLRX1 Protein Vector (Mouse) (pPB-C-His)

PV205834 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPB-N-His)

PV205835 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPM-C-HA)

PV205836 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPM-C-His)

PV205837 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPB-C-His)

PV205838 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPB-N-His)

PV205839 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPM-C-HA)

PV205840 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPM-C-His)

PV205841 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPB-C-His)

PV205842 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPB-N-His)

PV205843 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPM-C-HA)

PV205844 500 ng
EUR 1065

NLRX1 Protein Vector (Mouse) (pPM-C-His)

PV205845 500 ng
EUR 1065

NLRX1 Protein Vector (Rat) (pPB-C-His)

PV285450 500 ng
EUR 1166

NLRX1 Protein Vector (Rat) (pPB-N-His)

PV285451 500 ng
EUR 1166

NLRX1 Protein Vector (Rat) (pPM-C-HA)

PV285452 500 ng
EUR 1166

NLRX1 Protein Vector (Rat) (pPM-C-His)

PV285453 500 ng
EUR 1166

NLRX1 Protein Vector (Human) (pPB-C-His)

PV028441 500 ng
EUR 329

NLRX1 Protein Vector (Human) (pPB-N-His)

PV028442 500 ng
EUR 329

NLRX1 Protein Vector (Human) (pPM-C-HA)

PV028443 500 ng
EUR 329

NLRX1 Protein Vector (Human) (pPM-C-His)

PV028444 500 ng
EUR 329

Nlrx1 3'UTR Luciferase Stable Cell Line

TU114160 1.0 ml Ask for price

Nlrx1 3'UTR GFP Stable Cell Line

TU164160 1.0 ml Ask for price

Nlrx1 3'UTR Luciferase Stable Cell Line

TU214035 1.0 ml Ask for price

Nlrx1 3'UTR GFP Stable Cell Line

TU264035 1.0 ml Ask for price

NLRX1 3'UTR GFP Stable Cell Line

TU065763 1.0 ml
EUR 1394