Order Now: brent@sdlifesciences.com
 NLRX1 Polyclonal Antibody |
|
46745-100ul |
SAB |
100ul |
EUR 252 |
NLRX1 Polyclonal Antibody |
|
46745-50ul |
SAB |
50ul |
EUR 187 |
 NLRX1 Rabbit pAb |
|
A4976-100ul |
Abclonal |
100 ul |
EUR 308 |
NLRX1 Rabbit pAb |
|
A4976-200ul |
Abclonal |
200 ul |
EUR 459 |
NLRX1 Rabbit pAb |
|
A4976-20ul |
Abclonal |
20 ul |
EUR 183 |
NLRX1 Rabbit pAb |
|
A4976-50ul |
Abclonal |
50 ul |
EUR 223 |
 NLRX1 Polyclonal Conjugated Antibody |
|
C46745 |
SAB |
100ul |
EUR 397 |
NLRX1 Polyclonal Conjugated Antibody |
|
C30284 |
SAB |
100ul |
EUR 397 |
 NLRX1 antibody |
|
70R-18898 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal NLRX1 antibody |
 NLRX1 Antibody |
|
DF12124 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NLRX1 antibody detects endogenous levels of NLRX1. |
NLRX1 Antibody |
|
1-CSB-PA770306 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
NLRX1 Antibody |
|
1-CSB-PA015878GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
NLRX1 Antibody |
|
1-CSB-PA015878LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
) Polyclonal NLRX1 Antibody (aa580-630) |
|
APR02984G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 (aa580-630). This antibody is tested and proven to work in the following applications: |
 [KO Validated] NLRX1 Polyclonal Antibody |
|
30284-100ul |
SAB |
100ul |
EUR 252 |
[KO Validated] NLRX1 Polyclonal Antibody |
|
30284-50ul |
SAB |
50ul |
EUR 187 |
 Polyclonal NLRX1 Antibody - C-terminal region |
|
APR01607G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
) Polyclonal NLRX1 / NOD9 Antibody (internal region) |
|
APG00658G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NLRX1 / NOD9 (internal region). This antibody is tested and proven to work in the following applications: |
 [KO Validated] NLRX1 Rabbit pAb |
|
A18065-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] NLRX1 Rabbit pAb |
|
A18065-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] NLRX1 Rabbit pAb |
|
A18065-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] NLRX1 Rabbit pAb |
|
A18065-50ul |
Abclonal |
50 ul |
EUR 287 |
 anti- NLRX1 antibody |
|
FNab05759 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- IHC: 1:50-1:500
- IF: 1:10-1:100
- Immunogen: NLR family member X1
- Uniprot ID: Q86UT6
- Gene ID: 79671
- Research Area: Immunology
|
|
Description: Antibody raised against NLRX1 |
 Anti-NLRX1 antibody |
|
STJ98633 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to NLRX1. |
Anti-NLRX1 antibody |
|
STJ11100038 |
St John's Laboratory |
100 µl |
EUR 413 |
|
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. |
Anti-NLRX1 antibody |
|
STJ116270 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. |
 NLRX1 siRNA |
|
20-abx903578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLRX1 siRNA |
|
20-abx926038 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLRX1 siRNA |
|
20-abx926039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Anti-NLRX1/Nod9 Antibody |
|
A04980-1 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal Antibody for NLRX1 Antibody (NLRX1) detection.tested for IHC, WB in Human, Mouse, Rat. |
 NLRX1 Antibody, HRP conjugated |
|
1-CSB-PA015878LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 NLRX1 Antibody, FITC conjugated |
|
1-CSB-PA015878LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 NLRX1 Antibody, Biotin conjugated |
|
1-CSB-PA015878LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 NLRX1 cloning plasmid |
|
CSB-CL015878HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2079
- Sequence: atggctgctgctgggtcccacctcctctttgtgctccatggcttagagcatctcaacctcgacttccggctggcaggcacgggactttgtagtgacccggaggaaccgcaggaaccagctgctatcatcgtcaacctgctgcgcaaatacatgctgcctcaggccagcattctgg
- Show more
|
|
Description: A cloning plasmid for the NLRX1 gene. |
 NLRX1 Blocking Peptide |
|
DF12124-BP |
Affbiotech |
1mg |
EUR 195 |
 Rat NLRX1 shRNA Plasmid |
|
20-abx989892 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse NLRX1 shRNA Plasmid |
|
20-abx983099 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NLRX1 shRNA Plasmid |
|
20-abx962473 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Nlr Family Member X1 (NLRX1) Antibody |
|
20-abx114128 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) NLR Family Member X1 (NLRX1) Antibody |
|
abx146311-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
20-abx003793 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
20-abx329819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
abx430572-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
abx235759-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
20-abx301833 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) NLR Family Member X1 (NLRX1) Antibody (HRP) |
|
20-abx315867 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) NLR Family Member X1 (NLRX1) Antibody (FITC) |
|
20-abx315868 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) NLR Family Member X1 (NLRX1) Antibody (Biotin) |
|
20-abx315869 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) NLRX1 ORF Vector (Human) (pORF) |
|
ORF007111 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nlrx1 ORF Vector (Rat) (pORF) |
|
ORF071363 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Nlrx1 ORF Vector (Mouse) (pORF) |
|
ORF051459 |
ABM |
1.0 ug DNA |
EUR 506 |
Nlrx1 ORF Vector (Mouse) (pORF) |
|
ORF051460 |
ABM |
1.0 ug DNA |
EUR 506 |
Nlrx1 ORF Vector (Mouse) (pORF) |
|
ORF051461 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCA01393)) NLRX1 ELISA Kit (Human) (OKCA01393) |
|
OKCA01393 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: Participates in antiviral signaling. Acts as a negative regulator of MAVS-mediated antiviral responses, through the inhibition of the virus-induced RLH (RIG-like helicase)-MAVS interaction (PubMed:18200010). Has no inhibitory function on NF-Kappa-B and type 1 interferon signaling pathways, but enhances NF-Kappa-B and JUN N-terminal kinase dependent signaling through the production of reactive oxygen species (PubMed:18219313).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL |
) NLRX1 sgRNA CRISPR Lentivector set (Human) |
|
K1435001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nlrx1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4382001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nlrx1 sgRNA CRISPR Lentivector set (Rat) |
|
K6673301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) NLRX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1435002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NLRX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1435003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NLRX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1435004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4382002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4382003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4382004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6673302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6673303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6673304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NLRX1 Protein Vector (Human) (pPB-C-His) |
|
PV028441 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NLRX1 Protein Vector (Human) (pPB-N-His) |
|
PV028442 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NLRX1 Protein Vector (Human) (pPM-C-HA) |
|
PV028443 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NLRX1 Protein Vector (Human) (pPM-C-His) |
|
PV028444 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) NLRX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV205834 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) NLRX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV205835 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) NLRX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205836 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) NLRX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV205837 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV205838 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV205839 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205840 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV205841 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV205842 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV205843 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205844 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV205845 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) NLRX1 Protein Vector (Rat) (pPB-C-His) |
|
PV285450 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) NLRX1 Protein Vector (Rat) (pPB-N-His) |
|
PV285451 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) NLRX1 Protein Vector (Rat) (pPM-C-HA) |
|
PV285452 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) NLRX1 Protein Vector (Rat) (pPM-C-His) |
|
PV285453 |
ABM |
500 ng |
EUR 1166 |
 Nlrx1 3'UTR GFP Stable Cell Line |
|
TU164160 |
ABM |
1.0 ml |
Ask for price |
 NLRX1 3'UTR Luciferase Stable Cell Line |
|
TU015763 |
ABM |
1.0 ml |
EUR 1394 |
 Nlrx1 3'UTR Luciferase Stable Cell Line |
|
TU114160 |
ABM |
1.0 ml |
Ask for price |
 NLRX1 3'UTR GFP Stable Cell Line |
|
TU065763 |
ABM |
1.0 ml |
EUR 1394 |
Nlrx1 3'UTR GFP Stable Cell Line |
|
TU264035 |
ABM |
1.0 ml |
Ask for price |
Nlrx1 3'UTR Luciferase Stable Cell Line |
|
TU214035 |
ABM |
1.0 ml |
Ask for price |
 Human NLR family member X1, NLRX1 ELISA KIT |
|
ELI-20703h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse NLR family member X1, Nlrx1 ELISA KIT |
|
ELI-36952m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Human NLR Family Member X1 (NLRX1) ELISA Kit |
|
abx381825-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) NLRX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV622531 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) NLRX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV622535 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) NLRX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV622536 |
ABM |
1.0 ug DNA |
EUR 1355 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
