Order Now: brent@sdlifesciences.com
 NLRX1 Polyclonal Antibody |
|
ES8520-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NLRX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
NLRX1 Polyclonal Antibody |
|
ES8520-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NLRX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
 NLRX1 Rabbit pAb |
|
A4976-100ul |
Abclonal |
100 ul |
EUR 308 |
NLRX1 Rabbit pAb |
|
A4976-200ul |
Abclonal |
200 ul |
EUR 459 |
NLRX1 Rabbit pAb |
|
A4976-20ul |
Abclonal |
20 ul |
EUR 183 |
NLRX1 Rabbit pAb |
|
A4976-50ul |
Abclonal |
50 ul |
EUR 223 |
 NLRX1 Polyclonal Conjugated Antibody |
|
C30284 |
SAB |
100ul |
EUR 397 |
NLRX1 Polyclonal Conjugated Antibody |
|
C46745 |
SAB |
100ul |
EUR 397 |
 NLRX1 antibody |
|
70R-18898 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal NLRX1 antibody |
 NLRX1 Antibody |
|
1-CSB-PA770306 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
NLRX1 Antibody |
|
DF12124 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NLRX1 antibody detects endogenous levels of NLRX1. |
NLRX1 Antibody |
|
1-CSB-PA015878GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
NLRX1 Antibody |
|
1-CSB-PA015878LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 [KO Validated] NLRX1 Polyclonal Antibody |
|
30284-100ul |
SAB |
100ul |
EUR 252 |
[KO Validated] NLRX1 Polyclonal Antibody |
|
30284-50ul |
SAB |
50ul |
EUR 187 |
) Polyclonal NLRX1 Antibody (aa580-630) |
|
APR02984G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 (aa580-630). This antibody is tested and proven to work in the following applications: |
) Polyclonal NLRX1 / NOD9 Antibody (internal region) |
|
APG00658G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NLRX1 / NOD9 (internal region). This antibody is tested and proven to work in the following applications: |
 Polyclonal NLRX1 Antibody - C-terminal region |
|
APR01607G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRX1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 [KO Validated] NLRX1 Rabbit pAb |
|
A18065-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] NLRX1 Rabbit pAb |
|
A18065-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] NLRX1 Rabbit pAb |
|
A18065-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] NLRX1 Rabbit pAb |
|
A18065-50ul |
Abclonal |
50 ul |
EUR 287 |
 anti- NLRX1 antibody |
|
FNab05759 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- IHC: 1:50-1:500
- IF: 1:10-1:100
- Immunogen: NLR family member X1
- Uniprot ID: Q86UT6
- Gene ID: 79671
- Research Area: Immunology
|
|
Description: Antibody raised against NLRX1 |
 Anti-NLRX1 antibody |
|
STJ11100038 |
St John's Laboratory |
100 µl |
EUR 413 |
|
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. |
Anti-NLRX1 antibody |
|
STJ116270 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. |
Anti-NLRX1 antibody |
|
STJ98633 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to NLRX1. |
 NLRX1 siRNA |
|
20-abx903578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLRX1 siRNA |
|
20-abx926038 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLRX1 siRNA |
|
20-abx926039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Anti-NLRX1/Nod9 Antibody |
|
A04980-1 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal Antibody for NLRX1 Antibody (NLRX1) detection.tested for IHC, WB in Human, Mouse, Rat. |
 NLRX1 Antibody, HRP conjugated |
|
1-CSB-PA015878LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 NLRX1 Antibody, FITC conjugated |
|
1-CSB-PA015878LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 NLRX1 Antibody, Biotin conjugated |
|
1-CSB-PA015878LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against NLRX1. Recognizes NLRX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 NLRX1 Blocking Peptide |
|
DF12124-BP |
Affbiotech |
1mg |
EUR 195 |
 NLRX1 cloning plasmid |
|
CSB-CL015878HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2079
- Sequence: atggctgctgctgggtcccacctcctctttgtgctccatggcttagagcatctcaacctcgacttccggctggcaggcacgggactttgtagtgacccggaggaaccgcaggaaccagctgctatcatcgtcaacctgctgcgcaaatacatgctgcctcaggccagcattctgg
- Show more
|
|
Description: A cloning plasmid for the NLRX1 gene. |
 Rat NLRX1 shRNA Plasmid |
|
20-abx989892 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse NLRX1 shRNA Plasmid |
|
20-abx983099 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NLRX1 shRNA Plasmid |
|
20-abx962473 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) NLR Family Member X1 (NLRX1) Antibody |
|
20-abx003793 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 Antibody) Nlr Family Member X1 (NLRX1) Antibody |
|
20-abx114128 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
abx146311-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
abx235759-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
20-abx329819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
abx430572-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
NLR Family Member X1 (NLRX1) Antibody |
|
20-abx301833 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) NLR Family Member X1 (NLRX1) Antibody (HRP) |
|
20-abx315867 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) NLR Family Member X1 (NLRX1) Antibody (FITC) |
|
20-abx315868 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) NLR Family Member X1 (NLRX1) Antibody (Biotin) |
|
20-abx315869 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Nlrx1 ORF Vector (Rat) (pORF) |
|
ORF071363 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) NLRX1 ORF Vector (Human) (pORF) |
|
ORF007111 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nlrx1 ORF Vector (Mouse) (pORF) |
|
ORF051459 |
ABM |
1.0 ug DNA |
EUR 506 |
Nlrx1 ORF Vector (Mouse) (pORF) |
|
ORF051460 |
ABM |
1.0 ug DNA |
EUR 506 |
Nlrx1 ORF Vector (Mouse) (pORF) |
|
ORF051461 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCA01393)) NLRX1 ELISA Kit (Human) (OKCA01393) |
|
OKCA01393 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: Participates in antiviral signaling. Acts as a negative regulator of MAVS-mediated antiviral responses, through the inhibition of the virus-induced RLH (RIG-like helicase)-MAVS interaction (PubMed:18200010). Has no inhibitory function on NF-Kappa-B and type 1 interferon signaling pathways, but enhances NF-Kappa-B and JUN N-terminal kinase dependent signaling through the production of reactive oxygen species (PubMed:18219313).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL |
) Nlrx1 sgRNA CRISPR Lentivector set (Rat) |
|
K6673301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nlrx1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4382001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) NLRX1 sgRNA CRISPR Lentivector set (Human) |
|
K1435001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6673302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6673303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nlrx1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6673304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4382002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4382003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nlrx1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4382004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) NLRX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1435002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NLRX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1435003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NLRX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1435004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NLRX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV205834 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) NLRX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV205835 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) NLRX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205836 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) NLRX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV205837 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV205838 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV205839 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205840 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV205841 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV205842 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV205843 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205844 |
ABM |
500 ng |
EUR 1065 |
NLRX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV205845 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) NLRX1 Protein Vector (Rat) (pPB-C-His) |
|
PV285450 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) NLRX1 Protein Vector (Rat) (pPB-N-His) |
|
PV285451 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) NLRX1 Protein Vector (Rat) (pPM-C-HA) |
|
PV285452 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) NLRX1 Protein Vector (Rat) (pPM-C-His) |
|
PV285453 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) NLRX1 Protein Vector (Human) (pPB-C-His) |
|
PV028441 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NLRX1 Protein Vector (Human) (pPB-N-His) |
|
PV028442 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NLRX1 Protein Vector (Human) (pPM-C-HA) |
|
PV028443 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NLRX1 Protein Vector (Human) (pPM-C-His) |
|
PV028444 |
ABM |
500 ng |
EUR 329 |
 Nlrx1 3'UTR Luciferase Stable Cell Line |
|
TU114160 |
ABM |
1.0 ml |
Ask for price |
 Nlrx1 3'UTR GFP Stable Cell Line |
|
TU164160 |
ABM |
1.0 ml |
Ask for price |
Nlrx1 3'UTR Luciferase Stable Cell Line |
|
TU214035 |
ABM |
1.0 ml |
Ask for price |
Nlrx1 3'UTR GFP Stable Cell Line |
|
TU264035 |
ABM |
1.0 ml |
Ask for price |
 NLRX1 3'UTR GFP Stable Cell Line |
|
TU065763 |
ABM |
1.0 ml |
EUR 1394 |
 NLRX1 3'UTR Luciferase Stable Cell Line |
|
TU015763 |
ABM |
1.0 ml |
EUR 1394 |
 Human NLR family member X1, NLRX1 ELISA KIT |
|
ELI-20703h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human NLR Family Member X1 (NLRX1) ELISA Kit |
|
abx381825-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Mouse NLR family member X1, Nlrx1 ELISA KIT |
|
ELI-36952m |
Lifescience Market |
96 Tests |
EUR 865 |
 (CMV) (pLenti-GIII-CMV)) NLRX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV622531 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) NLRX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV622535 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) NLRX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV622536 |
ABM |
1.0 ug DNA |
EUR 1355 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
 MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
