Order Now: brent@sdlifesciences.com
MUM1 Polyclonal Antibody |
ABP57478-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from MUM1 at AA range: 661-710
- Applications tips:
|
Description: A polyclonal antibody for detection of MUM1 from Human, Mouse, Rat. This MUM1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MUM1 at AA range: 661-710 |
MUM1 Polyclonal Antibody |
ABP57478-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from MUM1 at AA range: 661-710
- Applications tips:
|
Description: A polyclonal antibody for detection of MUM1 from Human, Mouse, Rat. This MUM1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MUM1 at AA range: 661-710 |
MUM1 Polyclonal Antibody |
ABP57478-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from MUM1 at AA range: 661-710
- Applications tips:
|
Description: A polyclonal antibody for detection of MUM1 from Human, Mouse, Rat. This MUM1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MUM1 at AA range: 661-710 |
MUM1 Antibody |
BF0505 |
Affbiotech |
200ul |
EUR 376 |
Description: MUM1 antibody detects endogenous levels of total MUM1. |
MUM1 Antibody |
48448-100ul |
SAB |
100ul |
EUR 333 |
MUM1 Antibody |
48448-50ul |
SAB |
50ul |
EUR 239 |
MUM1 antibody |
10R-2189 |
Fitzgerald |
100 ul |
EUR 403 |
Description: Mouse monoclonal MUM1 antibody |
MUM1 antibody |
70R-18681 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MUM1 antibody |
MUM1 Antibody |
1-CSB-PA461204 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MUM1. Recognizes MUM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
MUM1 Antibody |
1-CSB-PA015236GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MUM1. Recognizes MUM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PWWP Domain-Containing Protein MUM1 (MUM1) Antibody |
20-abx113670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PWWP Domain-Containing Protein MUM1 (MUM1) Antibody |
abx011207-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
PWWP Domain-Containing Protein MUM1 (MUM1) Antibody |
abx029726-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
PWWP Domain-Containing Protein MUM1 (MUM1) Antibody |
abx029726-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
PWWP domain-containing protein MUM1 (MUM1) Antibody |
20-abx329818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PWWP Domain-Containing Protein MUM1 (MUM1) Antibody |
abx235437-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
MUM1 Conjugated Antibody |
C48448 |
SAB |
100ul |
EUR 397 |
anti- MUM1 antibody |
FNab05437 |
FN Test |
100µg |
EUR 585 |
- Immunogen: melanoma associated antigen(mutated) 1
- Uniprot ID: Q2TAK8
- Gene ID: 84939
- Research Area: Cancer, Immunology, Cell Division and Proliferation
|
Description: Antibody raised against MUM1 |
Anti-MUM1 Antibody |
A02544 |
BosterBio |
100 ug |
EUR 397 |
Description: Rabbit Polyclonal MUM1 Antibody. Validated in WB and tested in Human. |
Anti-MUM1 Antibody |
A02544-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for MUM1 Antibody (MUM1) detection. Tested with WB in Human, Mouse, Rat. |
Anti-MUM1 antibody |
STJ98258 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to MUM1. |
Anti-MUM1 antibody |
STJ98584 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MUM1. |
Anti-MUM1/IRF4 Rabbit Monoclonal Antibody (RM352) |
A1857-50 |
Biovision |
|
EUR 321 |
MUM1 siRNA |
20-abx903392 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUM1 siRNA |
20-abx925039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUM1 siRNA |
20-abx925040 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MUM1 |
YF-PA21531 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MUM1 |
anti-MUM1 |
YF-PA24008 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MUM1 |
Anti-MUM1/IRF4 Rabbit Monoclonal Antibody, Clone#RM352 |
M00401-1 |
BosterBio |
100uL |
EUR 397 |
Description: Anti-MUM1/IRF4 Rabbit Monoclonal Antibody, Clone#RM352 tested in WB, IHC, reactive to Human |
Anti-MUM1/IRF4 Antibody |
PB9222 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-MUM1 Monoclonal Antibody |
M00401 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal MUM1 Antibody. Validated in IP, IF, WB and tested in Human. |
MUM1 Blocking Peptide |
BF0505-BP |
Affbiotech |
1mg |
EUR 195 |
MUM1 cloning plasmid |
CSB-CL648777HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 570
- Sequence: atgtccagggttccagggcccggtggcctgggagctgctttctccccactggctgggctgcatctggccctggctggaggccttgctttgaggggctgtgaccctcttcccccaggccctccccagccgacgacagccaccggagaggagatcggaacacgattgtctcagatgca
- Show more
|
Description: A cloning plasmid for the MUM1 gene. |
MUM1 cloning plasmid |
CSB-CL648777HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 459
- Sequence: atgctccccgaccgctcgcgggccgcccgggaccgggccaaccagaagctggtggagtacattgtgaaggccaagggcgcggagagccacctgcgggccatcctaaagagcaggaagccatctcgctggctgcagaccttcctgagctccagccagtacgtgacctgtgtggagac
- Show more
|
Description: A cloning plasmid for the MUM1 gene. |
MUM1 cloning plasmid |
CSB-CL648777HU3-10ug |
Cusabio |
10ug |
EUR 650 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1929
- Sequence: atggtcagtgcctcacagaatgaggttcctgcggcacccctggaagaactggcctacagacggtcgcttcgcgtggctctggacgttctgagcgagggctcgatttggagtcaagaaagctctgcagggacaggtagagctgaccggtctctgcgagggaagcccatggagcatg
- Show more
|
Description: A cloning plasmid for the MUM1 gene. |
anti-MUM1 (4G10) |
LF-MA30395 |
Abfrontier |
100 ul |
EUR 486 |
Description: Mouse Monoclonal to MUM1 |
Anti-MUM1 (3A10) |
YF-MA13854 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MUM1 |
Anti-MUM1 (2D1) |
YF-MA13855 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MUM1 |
Anti-MUM1 (3C4) |
YF-MA13856 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MUM1 |
Monoclonal MUM1 Antibody, Clone: 4G10 |
AMM02768G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human MUM1. The antibodies are raised in Mouse and are from clone 4G10. This antibody is applicable in WB and IHC, E |
MUM1 Like 1 (MUM1L1) Antibody |
abx028468-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MUM1 Like 1 (MUM1L1) Antibody |
abx028468-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MUM1 Like 1 (MUM1L1) Antibody |
abx235438-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Cow PWWP domain-containing protein MUM1 (MUM1) ELISA Kit |
abx515429-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse PWWP domain-containing protein MUM1 (MUM1) ELISA Kit |
abx515431-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat PWWP domain-containing protein MUM1 (MUM1) ELISA Kit |
abx515432-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human MUM1/ PWWP domain-containing protein MUM1 ELISA Kit |
E1677Hu |
Sunlong |
1 Kit |
EUR 571 |
Human MUM1(PWWP domain-containing protein MUM1) ELISA Kit |
EH1301 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q2TAK8
- Alias: MUM1(Mutated melanoma-associated antigen 1)/LSIRF/NF-EM5/interferon regulatory factor 4/IRF-4/Lymphocyte-specific interferon regulatory factor/Multiple myeloma oncogene 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Bovine PWWP domain- containing protein MUM1, MUM1 ELISA KIT |
ELI-03758b |
Lifescience Market |
96 Tests |
EUR 928 |
Human PWWP domain- containing protein MUM1, MUM1 ELISA KIT |
ELI-03759h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse PWWP domain- containing protein MUM1, Mum1 ELISA KIT |
ELI-03760m |
Lifescience Market |
96 Tests |
EUR 865 |
Human PWWP domain-containing protein MUM1 (MUM1) ELISA Kit |
abx250566-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse MUM1 shRNA Plasmid |
20-abx976495 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat MUM1 shRNA Plasmid |
20-abx990455 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MUM1 shRNA Plasmid |
20-abx963709 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MUM1 Recombinant Protein (Human) |
RP020401 |
ABM |
100 ug |
Ask for price |
MUM1 Recombinant Protein (Human) |
RP020404 |
ABM |
100 ug |
Ask for price |
MUM1 Recombinant Protein (Human) |
RP041482 |
ABM |
100 ug |
Ask for price |
MUM1 Recombinant Protein (Rat) |
RP212792 |
ABM |
100 ug |
Ask for price |
MUM1 Recombinant Protein (Mouse) |
RP152273 |
ABM |
100 ug |
Ask for price |
Monoclonal MUM1 Antibody (clone 4G10), Clone: 4G10 |
AMM01897G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human MUM1 (clone 4G10). The antibodies are raised in Mouse and are from clone 4G10. This antibody is applicable in WB and IHC-P, E |
MUM1 ORF Vector (Human) (pORF) |
ORF006801 |
ABM |
1.0 ug DNA |
EUR 95 |
MUM1 ORF Vector (Human) (pORF) |
ORF006802 |
ABM |
1.0 ug DNA |
EUR 95 |
Mum1 ORF Vector (Mouse) (pORF) |
ORF050759 |
ABM |
1.0 ug DNA |
EUR 506 |
Mum1 ORF Vector (Rat) (pORF) |
ORF070932 |
ABM |
1.0 ug DNA |
EUR 506 |
MUM1 ORF Vector (Human) (pORF) |
ORF013828 |
ABM |
1.0 ug DNA |
EUR 354 |
MUM1 ELISA Kit (Human) (OKEH04636) |
OKEH04636 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL |
MUM1 ELISA Kit (Mouse) (OKEH05655) |
OKEH05655 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL |
MUM1 ELISA Kit (Rat) (OKEH06222) |
OKEH06222 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL |
Mouse Anti-Human MUM1 monoclonal antibody, clone JID738 |
CABT-L2922-100uL500uL |
Creative Diagnostics |
100 uL, 500 uL |
EUR 502 |
MUM1 sgRNA CRISPR Lentivector set (Human) |
K1368601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mum1 sgRNA CRISPR Lentivector set (Mouse) |
K4925301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mum1 sgRNA CRISPR Lentivector set (Rat) |
K6604801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human MUM1 Like 1 (MUM1L1) ELISA Kit |
abx381616-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
MUM1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1368602 |
ABM |
1.0 ug DNA |
EUR 154 |
MUM1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1368603 |
ABM |
1.0 ug DNA |
EUR 154 |
MUM1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1368604 |
ABM |
1.0 ug DNA |
EUR 154 |
Mum1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4925302 |
ABM |
1.0 ug DNA |
EUR 154 |
Mum1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4925303 |
ABM |
1.0 ug DNA |
EUR 154 |
Mum1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4925304 |
ABM |
1.0 ug DNA |
EUR 154 |
Mum1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6604802 |
ABM |
1.0 ug DNA |
EUR 154 |
Mum1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6604803 |
ABM |
1.0 ug DNA |
EUR 154 |
Mum1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6604804 |
ABM |
1.0 ug DNA |
EUR 154 |
MUM1 Protein Vector (Human) (pPB-C-His) |
PV055309 |
ABM |
500 ng |
EUR 481 |
MUM1 Protein Vector (Human) (pPB-N-His) |
PV055310 |
ABM |
500 ng |
EUR 481 |
MUM1 Protein Vector (Human) (pPM-C-HA) |
PV055311 |
ABM |
500 ng |
EUR 481 |
MUM1 Protein Vector (Human) (pPM-C-His) |
PV055312 |
ABM |
500 ng |
EUR 481 |
MUM1 Protein Vector (Rat) (pPB-C-His) |
PV283726 |
ABM |
500 ng |
EUR 1166 |
MUM1 Protein Vector (Rat) (pPB-N-His) |
PV283727 |
ABM |
500 ng |
EUR 1166 |
MUM1 Protein Vector (Rat) (pPM-C-HA) |
PV283728 |
ABM |
500 ng |
EUR 1166 |
MUM1 Protein Vector (Rat) (pPM-C-His) |
PV283729 |
ABM |
500 ng |
EUR 1166 |
MUM1 Protein Vector (Human) (pPB-C-His) |
PV027201 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPB-N-His) |
PV027202 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPM-C-HA) |
PV027203 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPM-C-His) |
PV027204 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPB-C-His) |
PV027205 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPB-N-His) |
PV027206 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPM-C-HA) |
PV027207 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Human) (pPM-C-His) |
PV027208 |
ABM |
500 ng |
EUR 329 |
MUM1 Protein Vector (Mouse) (pPB-C-His) |
PV203034 |
ABM |
500 ng |
EUR 1065 |
MUM1 Protein Vector (Mouse) (pPB-N-His) |
PV203035 |
ABM |
500 ng |
EUR 1065 |
MUM1 Protein Vector (Mouse) (pPM-C-HA) |
PV203036 |
ABM |
500 ng |
EUR 1065 |
MUM1 Protein Vector (Mouse) (pPM-C-His) |
PV203037 |
ABM |
500 ng |
EUR 1065 |
Mum1 3'UTR GFP Stable Cell Line |
TU163631 |
ABM |
1.0 ml |
Ask for price |
Mum1 3'UTR Luciferase Stable Cell Line |
TU213573 |
ABM |
1.0 ml |
Ask for price |
MUM1 3'UTR Luciferase Stable Cell Line |
TU014979 |
ABM |
1.0 ml |
EUR 1521 |
Mum1 3'UTR Luciferase Stable Cell Line |
TU113631 |
ABM |
1.0 ml |
Ask for price |
MUM1 3'UTR GFP Stable Cell Line |
TU064979 |
ABM |
1.0 ml |
EUR 1521 |
Mum1 3'UTR GFP Stable Cell Line |
TU263573 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |