Order Now: brent@sdlifesciences.com
Polyclonal MIB1 Antibody |
APR17811G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MIB1 . This antibody is tested and proven to work in the following applications: |
MIB1 Polyclonal Antibody |
A54177 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
MIB1 Polyclonal Antibody |
ABP57540-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic peptide from human protein at AA range: 901-950
- Applications tips:
|
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950 |
MIB1 Polyclonal Antibody |
ABP57540-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic peptide from human protein at AA range: 901-950
- Applications tips:
|
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950 |
MIB1 Polyclonal Antibody |
ABP57540-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic peptide from human protein at AA range: 901-950
- Applications tips:
|
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950 |
MIB1 Polyclonal Antibody |
ES8533-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MIB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MIB1 Polyclonal Antibody |
ES8533-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MIB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MIB1 Rabbit pAb |
A8588-100ul |
Abclonal |
100 ul |
EUR 308 |
MIB1 Rabbit pAb |
A8588-200ul |
Abclonal |
200 ul |
EUR 459 |
MIB1 Rabbit pAb |
A8588-20ul |
Abclonal |
20 ul |
EUR 183 |
MIB1 Rabbit pAb |
A8588-50ul |
Abclonal |
50 ul |
EUR 223 |
MIB1 Polyclonal Conjugated Antibody |
C46750 |
SAB |
100ul |
EUR 397 |
MIB1 antibody |
70R-15269 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MIB1 antibody |
Mib1 Antibody |
49913-100ul |
SAB |
100ul |
EUR 333 |
Mib1 Antibody |
49913-50ul |
SAB |
50ul |
EUR 239 |
MIB1 Antibody |
45277-100ul |
SAB |
100ul |
EUR 252 |
MIB1 Antibody |
45277-50ul |
SAB |
50ul |
EUR 187 |
MIB1 Antibody |
1-CSB-PA13289A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
mib1 Antibody |
1-CSB-PA896152LA01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA |
MIB1 Antibody |
DF8340 |
Affbiotech |
200ul |
EUR 304 |
Description: MIB1 Antibody detects endogenous levels of total MIB1. |
MIB1 Antibody |
1-CSB-PA287419 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000ELISA:1:10000 |
MIB1 Polyclonal Antibody, HRP Conjugated |
A54178 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
MIB1 Polyclonal Antibody, FITC Conjugated |
A54179 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
MIB1 Polyclonal Antibody, Biotin Conjugated |
A54180 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody |
20-abx216853 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody |
20-abx124134 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody |
20-abx320032 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody |
abx224331-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody |
abx224444-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Polyclonal Mib1/Mindbomb Antibody (N-term) |
AMM08648G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mib1/Mindbomb (N-term). This antibody is tested and proven to work in the following applications: |
MIB1 antibody (HRP) |
60R-1645 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MIB1 antibody (HRP) |
MIB1 antibody (FITC) |
60R-1646 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MIB1 antibody (FITC) |
MIB1 antibody (biotin) |
60R-1647 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MIB1 antibody (biotin) |
Mib1 / Mindbomb Antibody |
abx031563-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mib1 / Mindbomb Antibody |
abx031563-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mib1 Conjugated Antibody |
C49913 |
SAB |
100ul |
EUR 397 |
MIB1 Conjugated Antibody |
C45277 |
SAB |
100ul |
EUR 397 |
Anti-MIB1 antibody |
STJ111320 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). |
Anti-MIB1 antibody |
STJ98646 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MIB1. |
E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody Pair |
abx117552-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (HRP) |
20-abx320033 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (FITC) |
20-abx320034 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (Biotin) |
20-abx320035 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 ubiquitin-protein ligase MIB1 Polyclonal Antibody |
42567-100ul |
SAB |
100ul |
EUR 333 |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human) |
4-PAL727Hu01 |
Cloud-Clone |
-
EUR 261.00
-
EUR 2734.00
-
EUR 676.00
-
EUR 330.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1) |
MIB1 siRNA |
20-abx924120 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MIB1 siRNA |
20-abx924121 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MIB1 Antibody, HRP conjugated |
1-CSB-PA13289B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MIB1 Antibody, FITC conjugated |
1-CSB-PA13289C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MIB1 Antibody, Biotin conjugated |
1-CSB-PA13289D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
mib1 Antibody, HRP conjugated |
1-CSB-PA896152LB01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA |
mib1 Antibody, FITC conjugated |
1-CSB-PA896152LC01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA |
mib1 Antibody, Biotin conjugated |
1-CSB-PA896152LD01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-Mib1/Mindbomb Antibody |
A01387-1 |
BosterBio |
100ug/vial |
EUR 294 |
Human E3 ubiquitin-protein ligase MIB1 (MIB1) |
1-CSB-RP132874h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 40.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human E3 ubiquitin-protein ligase MIB1(MIB1) ,partial expressed in E.coli |
E3 ubiquitin-protein ligase MIB1 Polyclonal Conjugated Antibody |
C42567 |
SAB |
100ul |
EUR 397 |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), APC |
4-PAL727Hu01-APC |
Cloud-Clone |
-
EUR 367.00
-
EUR 3581.00
-
EUR 989.00
-
EUR 470.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with APC. |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), Biotinylated |
4-PAL727Hu01-Biotin |
Cloud-Clone |
-
EUR 327.00
-
EUR 2684.00
-
EUR 783.00
-
EUR 403.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with Biotin. |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), Cy3 |
4-PAL727Hu01-Cy3 |
Cloud-Clone |
-
EUR 447.00
-
EUR 4733.00
-
EUR 1277.00
-
EUR 585.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with Cy3. |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), FITC |
4-PAL727Hu01-FITC |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with FITC. |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), HRP |
4-PAL727Hu01-HRP |
Cloud-Clone |
-
EUR 334.00
-
EUR 3120.00
-
EUR 873.00
-
EUR 424.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with HRP. |
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), PE |
4-PAL727Hu01-PE |
Cloud-Clone |
-
EUR 313.00
-
EUR 2884.00
-
EUR 811.00
-
EUR 396.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with PE. |
MIB1 Blocking Peptide |
DF8340-BP |
Affbiotech |
1mg |
EUR 195 |
MIB1 cloning plasmid |
CSB-CL771476HU-10ug |
Cusabio |
10ug |
EUR 1085 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3021
- Sequence: ATGAGTAACTCCCGGAATAACCGGGTGATGGTGGAAGGGGTTGGCGCTCGGGTAGTGCGCGGCCCGGACTGGAAGTGGGGGAAGCAGGACGGCGGCGAGGGCCATGTGGGCACCGTCCGGAGCTTCGAGAGCCCCGAGGAGGTGGTGGTAGTGTGGGACAACGGCACAGCTGCCA
- Show more
|
Description: A cloning plasmid for the MIB1 gene. |
anti-Mib1/Mindbomb |
YF-PA26487 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Mib1/Mindbomb |
Mindbomb Homolog 1 (MIB1) Antibody |
20-abx101780 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAL727Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 614.00
-
EUR 7042.00
-
EUR 1858.00
-
EUR 821.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MIB1 (Arg769~Glu1000)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with APC-Cy7. |
Human E3 ubiquitin- protein ligase MIB1, MIB1 ELISA KIT |
ELI-43761h |
Lifescience Market |
96 Tests |
EUR 824 |
Human E3 ubiquitin-protein ligase MIB1 (MIB1) ELISA Kit |
abx385152-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse E3 ubiquitin-protein ligase MIB1 (MIB1) ELISA Kit |
abx389880-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse E3 ubiquitin- protein ligase MIB1, Mib1 ELISA KIT |
ELI-37178m |
Lifescience Market |
96 Tests |
EUR 865 |
E3 ubiquitin-protein ligase MIB1 Antibody |
20-abx109743 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human MIB1 shRNA Plasmid |
20-abx961514 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MIB1 shRNA Plasmid |
20-abx981387 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-Mib1/Mindbomb (3E10) |
YF-MA19072 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Mib1/Mindbomb |
Anti-Mib1/Mindbomb (2A9) |
YF-MA19073 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Mib1/Mindbomb |
Mib1 ELISA Kit| Mouse E3 ubiquitin-protein ligase MIB1 ELISA Ki |
EF015517 |
Lifescience Market |
96 Tests |
EUR 689 |
E3 ubiquitin-protein ligase MIB1 Antibody (Biotin) |
20-abx105364 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 ubiquitin-protein ligase MIB1 Antibody (FITC) |
20-abx106783 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 ubiquitin-protein ligase MIB1 Antibody (HRP) |
20-abx108202 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
E3 Ubiquitin-Protein Ligase MIB1 (SAG2) Antibody |
abx224359-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Mib1 ORF Vector (Rat) (pORF) |
ORF070574 |
ABM |
1.0 ug DNA |
EUR 506 |
MIB1 ORF Vector (Human) (pORF) |
ORF013778 |
ABM |
1.0 ug DNA |
EUR 354 |
Mib1 ORF Vector (Mouse) (pORF) |
ORF050195 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Mindbomb Homolog 1 (MIB1) |
4-RPL727Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q86YT6
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Mindbomb Homolog 1 expressed in: E.coli |
Mindbomb E3 Ubiquitin Protein Ligase 1 (MIB1) Antibody |
20-abx329794 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Mindbomb Homolog 1 (MIB1) Protein |
20-abx068021 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mib1 sgRNA CRISPR Lentivector set (Rat) |
K6736201 |
ABM |
3 x 1.0 ug |
EUR 339 |
MIB1 sgRNA CRISPR Lentivector set (Human) |
K1300701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mib1 sgRNA CRISPR Lentivector set (Mouse) |
K4198401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mib1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6736202 |
ABM |
1.0 ug DNA |
EUR 154 |
Mib1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6736203 |
ABM |
1.0 ug DNA |
EUR 154 |
Mib1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6736204 |
ABM |
1.0 ug DNA |
EUR 154 |
MIB1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1300702 |
ABM |
1.0 ug DNA |
EUR 154 |
MIB1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1300703 |
ABM |
1.0 ug DNA |
EUR 154 |
MIB1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1300704 |
ABM |
1.0 ug DNA |
EUR 154 |
Mib1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4198402 |
ABM |
1.0 ug DNA |
EUR 154 |
Mib1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4198403 |
ABM |
1.0 ug DNA |
EUR 154 |
Mib1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4198404 |
ABM |
1.0 ug DNA |
EUR 154 |
MIB1 Protein Vector (Mouse) (pPB-C-His) |
PV200778 |
ABM |
500 ng |
EUR 1065 |
MIB1 Protein Vector (Mouse) (pPB-N-His) |
PV200779 |
ABM |
500 ng |
EUR 1065 |
MIB1 Protein Vector (Mouse) (pPM-C-HA) |
PV200780 |
ABM |
500 ng |
EUR 1065 |
MIB1 Protein Vector (Mouse) (pPM-C-His) |
PV200781 |
ABM |
500 ng |
EUR 1065 |
MIB1 Protein Vector (Rat) (pPB-C-His) |
PV282294 |
ABM |
500 ng |
EUR 1166 |
MIB1 Protein Vector (Rat) (pPB-N-His) |
PV282295 |
ABM |
500 ng |
EUR 1166 |
MIB1 Protein Vector (Rat) (pPM-C-HA) |
PV282296 |
ABM |
500 ng |
EUR 1166 |
MIB1 Protein Vector (Rat) (pPM-C-His) |
PV282297 |
ABM |
500 ng |
EUR 1166 |
MIB1 Protein Vector (Human) (pPB-C-His) |
PV055109 |
ABM |
500 ng |
EUR 481 |
MIB1 Protein Vector (Human) (pPB-N-His) |
PV055110 |
ABM |
500 ng |
EUR 481 |
MIB1 Protein Vector (Human) (pPM-C-HA) |
PV055111 |
ABM |
500 ng |
EUR 481 |
MIB1 Protein Vector (Human) (pPM-C-His) |
PV055112 |
ABM |
500 ng |
EUR 481 |
Mib1 3'UTR Luciferase Stable Cell Line |
TU113188 |
ABM |
1.0 ml |
Ask for price |
Mib1 3'UTR GFP Stable Cell Line |
TU163188 |
ABM |
1.0 ml |
Ask for price |
Mib1 3'UTR Luciferase Stable Cell Line |
TU213178 |
ABM |
1.0 ml |
Ask for price |
Mib1 3'UTR GFP Stable Cell Line |
TU263178 |
ABM |
1.0 ml |
Ask for price |
MIB1 3'UTR GFP Stable Cell Line |
TU063339 |
ABM |
1.0 ml |
EUR 4617 |
MIB1 3'UTR Luciferase Stable Cell Line |
TU013339 |
ABM |
1.0 ml |
EUR 4617 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |