MIB1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

Polyclonal MIB1 Antibody
APR17811G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MIB1 . This antibody is tested and proven to work in the following applications:

MIB1 Polyclonal Antibody
A54177 100 µg
EUR 570.55
Description: kits suitable for this type of research

MIB1 Polyclonal Antibody
ABP57540-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 901-950
  • Applications tips:
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950

MIB1 Polyclonal Antibody
ABP57540-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 901-950
  • Applications tips:
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950

MIB1 Polyclonal Antibody
ABP57540-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 901-950
  • Applications tips:
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950

MIB1 Polyclonal Antibody
ES8533-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MIB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MIB1 Polyclonal Antibody
ES8533-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MIB1 Rabbit pAb
A8588-100ul 100 ul
EUR 308

MIB1 Rabbit pAb
A8588-200ul 200 ul
EUR 459

MIB1 Rabbit pAb
A8588-20ul 20 ul
EUR 183

MIB1 Rabbit pAb
A8588-50ul 50 ul
EUR 223

MIB1 Polyclonal Conjugated Antibody
C46750 100ul
EUR 397

MIB1 antibody
70R-15269 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody

Mib1 Antibody
49913-100ul 100ul
EUR 333

Mib1 Antibody
49913-50ul 50ul
EUR 239

MIB1 Antibody
45277-100ul 100ul
EUR 252

MIB1 Antibody
45277-50ul 50ul
EUR 187

MIB1 Antibody
1-CSB-PA13289A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

mib1 Antibody
1-CSB-PA896152LA01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA

MIB1 Antibody
DF8340 200ul
EUR 304
Description: MIB1 Antibody detects endogenous levels of total MIB1.

MIB1 Antibody
1-CSB-PA287419
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000ELISA:1:10000

MIB1 Antibody
ABD8340 100 ug
EUR 438

MIB1 Polyclonal Antibody, HRP Conjugated
A54178 100 µg
EUR 570.55
Description: fast delivery possible

MIB1 Polyclonal Antibody, FITC Conjugated
A54179 100 µg
EUR 570.55
Description: reagents widely cited

MIB1 Polyclonal Antibody, Biotin Conjugated
A54180 100 µg
EUR 570.55
Description: Ask the seller for details

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
20-abx216853
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
20-abx124134
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody
20-abx320032
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
abx224331-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
abx224444-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Polyclonal Mib1/Mindbomb Antibody (N-term)
AMM08648G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mib1/Mindbomb (N-term). This antibody is tested and proven to work in the following applications:

MIB1 antibody (HRP)
60R-1645 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody (HRP)

MIB1 antibody (FITC)
60R-1646 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody (FITC)

MIB1 antibody (biotin)
60R-1647 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody (biotin)

Mib1 / Mindbomb Antibody
abx031563-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mib1 / Mindbomb Antibody
abx031563-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mib1 Conjugated Antibody
C49913 100ul
EUR 397

MIB1 Conjugated Antibody
C45277 100ul
EUR 397

Anti-MIB1 antibody
STJ111320 100 µl
EUR 277
Description: This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1).

Anti-MIB1 antibody
STJ98646 200 µl
EUR 197
Description: Rabbit polyclonal to MIB1.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody Pair
abx117552-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (HRP)
20-abx320033
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (FITC)
20-abx320034
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (Biotin)
20-abx320035
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 ubiquitin-protein ligase MIB1 Polyclonal Antibody
42567-100ul 100ul
EUR 333

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human)
4-PAL727Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1)

MIB1 siRNA
20-abx924120
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIB1 siRNA
20-abx924121
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIB1 Antibody, HRP conjugated
1-CSB-PA13289B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MIB1 Antibody, FITC conjugated
1-CSB-PA13289C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MIB1 Antibody, Biotin conjugated
1-CSB-PA13289D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

mib1 Antibody, HRP conjugated
1-CSB-PA896152LB01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA

mib1 Antibody, FITC conjugated
1-CSB-PA896152LC01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA

mib1 Antibody, Biotin conjugated
1-CSB-PA896152LD01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Mib1/Mindbomb Antibody
A01387-1 100ug/vial
EUR 294

Human E3 ubiquitin-protein ligase MIB1 (MIB1)
1-CSB-RP132874h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase MIB1(MIB1) ,partial expressed in E.coli

E3 ubiquitin-protein ligase MIB1 Polyclonal Conjugated Antibody
C42567 100ul
EUR 397

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), APC
4-PAL727Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with APC.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), Biotinylated
4-PAL727Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with Biotin.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), Cy3
4-PAL727Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with Cy3.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), FITC
4-PAL727Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with FITC.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), HRP
4-PAL727Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with HRP.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), PE
4-PAL727Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with PE.

MIB1 Blocking Peptide
DF8340-BP 1mg
EUR 195

MIB1 cloning plasmid
CSB-CL771476HU-10ug 10ug
EUR 1085
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3021
  • Sequence: ATGAGTAACTCCCGGAATAACCGGGTGATGGTGGAAGGGGTTGGCGCTCGGGTAGTGCGCGGCCCGGACTGGAAGTGGGGGAAGCAGGACGGCGGCGAGGGCCATGTGGGCACCGTCCGGAGCTTCGAGAGCCCCGAGGAGGTGGTGGTAGTGTGGGACAACGGCACAGCTGCCA
  • Show more
Description: A cloning plasmid for the MIB1 gene.

anti-Mib1/Mindbomb
YF-PA26487 50 ul
EUR 334
Description: Mouse polyclonal to Mib1/Mindbomb

Mindbomb Homolog 1 (MIB1) Antibody
20-abx101780
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), APC-Cy7
4-PAL727Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with APC-Cy7.

Human E3 ubiquitin- protein ligase MIB1, MIB1 ELISA KIT
ELI-43761h 96 Tests
EUR 824

Human E3 ubiquitin-protein ligase MIB1 (MIB1) ELISA Kit
abx385152-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse E3 ubiquitin-protein ligase MIB1 (MIB1) ELISA Kit
abx389880-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse E3 ubiquitin- protein ligase MIB1, Mib1 ELISA KIT
ELI-37178m 96 Tests
EUR 865

E3 ubiquitin-protein ligase MIB1 Antibody
20-abx109743
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MIB1 ELISA KIT|Human
EF005271 96 Tests
EUR 689

Human MIB1 shRNA Plasmid
20-abx961514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MIB1 shRNA Plasmid
20-abx981387
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Mib1/Mindbomb (3E10)
YF-MA19072 100 ug
EUR 363
Description: Mouse monoclonal to Mib1/Mindbomb

Anti-Mib1/Mindbomb (2A9)
YF-MA19073 100 ug
EUR 363
Description: Mouse monoclonal to Mib1/Mindbomb

Mib1 ELISA Kit| Mouse E3 ubiquitin-protein ligase MIB1 ELISA Ki
EF015517 96 Tests
EUR 689

E3 ubiquitin-protein ligase MIB1 Antibody (Biotin)
20-abx105364
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 ubiquitin-protein ligase MIB1 Antibody (FITC)
20-abx106783
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 ubiquitin-protein ligase MIB1 Antibody (HRP)
20-abx108202
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (SAG2) Antibody
abx224359-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Mib1 ORF Vector (Rat) (pORF)
ORF070574 1.0 ug DNA
EUR 506

MIB1 ORF Vector (Human) (pORF)
ORF013778 1.0 ug DNA
EUR 354

Mib1 ORF Vector (Mouse) (pORF)
ORF050195 1.0 ug DNA
EUR 506

Recombinant Mindbomb Homolog 1 (MIB1)
4-RPL727Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86YT6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Mindbomb Homolog 1 expressed in: E.coli

pECMV-Mib1-m-FLAG Plasmid
PVT15014 2 ug
EUR 325

Mindbomb E3 Ubiquitin Protein Ligase 1 (MIB1) Antibody
20-abx329794
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Mindbomb Homolog 1 (MIB1) Protein
20-abx068021
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mib1 sgRNA CRISPR Lentivector set (Rat)
K6736201 3 x 1.0 ug
EUR 339

MIB1 sgRNA CRISPR Lentivector set (Human)
K1300701 3 x 1.0 ug
EUR 339

Mib1 sgRNA CRISPR Lentivector set (Mouse)
K4198401 3 x 1.0 ug
EUR 339

Mib1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6736202 1.0 ug DNA
EUR 154

Mib1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6736203 1.0 ug DNA
EUR 154

Mib1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6736204 1.0 ug DNA
EUR 154

MIB1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1300702 1.0 ug DNA
EUR 154

MIB1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1300703 1.0 ug DNA
EUR 154

MIB1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1300704 1.0 ug DNA
EUR 154

Mib1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4198402 1.0 ug DNA
EUR 154

Mib1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4198403 1.0 ug DNA
EUR 154

Mib1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4198404 1.0 ug DNA
EUR 154

MIB1 Protein Vector (Mouse) (pPB-C-His)
PV200778 500 ng
EUR 1065

MIB1 Protein Vector (Mouse) (pPB-N-His)
PV200779 500 ng
EUR 1065

MIB1 Protein Vector (Mouse) (pPM-C-HA)
PV200780 500 ng
EUR 1065

MIB1 Protein Vector (Mouse) (pPM-C-His)
PV200781 500 ng
EUR 1065

MIB1 Protein Vector (Rat) (pPB-C-His)
PV282294 500 ng
EUR 1166

MIB1 Protein Vector (Rat) (pPB-N-His)
PV282295 500 ng
EUR 1166

MIB1 Protein Vector (Rat) (pPM-C-HA)
PV282296 500 ng
EUR 1166

MIB1 Protein Vector (Rat) (pPM-C-His)
PV282297 500 ng
EUR 1166

MIB1 Protein Vector (Human) (pPB-C-His)
PV055109 500 ng
EUR 481

MIB1 Protein Vector (Human) (pPB-N-His)
PV055110 500 ng
EUR 481

MIB1 Protein Vector (Human) (pPM-C-HA)
PV055111 500 ng
EUR 481

MIB1 Protein Vector (Human) (pPM-C-His)
PV055112 500 ng
EUR 481

Mib1 3'UTR Luciferase Stable Cell Line
TU113188 1.0 ml Ask for price

Mib1 3'UTR GFP Stable Cell Line
TU163188 1.0 ml Ask for price

Mib1 3'UTR Luciferase Stable Cell Line
TU213178 1.0 ml Ask for price

Mib1 3'UTR GFP Stable Cell Line
TU263178 1.0 ml Ask for price

MIB1 3'UTR GFP Stable Cell Line
TU063339 1.0 ml
EUR 4617

MIB1 3'UTR Luciferase Stable Cell Line
TU013339 1.0 ml
EUR 4617

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3