Order Now: brent@sdlifesciences.com
MAD2L1BP Polyclonal Antibody |
ABP57070-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of MAD2L1BP from Human. This MAD2L1BP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90 |
MAD2L1BP Polyclonal Antibody |
ABP57070-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90
- Applications tips:
|
Description: A polyclonal antibody for detection of MAD2L1BP from Human. This MAD2L1BP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human MAD2L1BP at AA range: 10-90 |
MAD2L1BP antibody |
70R-50725 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MAD2L1BP antibody |
MAD2L1BP antibody |
70R-35640 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MAD2L1BP antibody |
MAD2L1BP Antibody |
34774-100ul |
SAB |
100ul |
EUR 252 |
MAD2L1BP Antibody |
34774-50ul |
SAB |
50ul |
EUR 187 |
MAD2L1BP antibody |
70R-18350 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MAD2L1BP antibody |
MAD2L1BP antibody |
70R-10299 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MAD2L1BP antibody |
MAD2L1BP Antibody |
CSB-PA901414- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
MAD2L1BP Antibody |
CSB-PA901414-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
MAD2L1BP Antibody |
DF4150 |
Affbiotech |
200ul |
EUR 304 |
Description: MAD2L1BP Antibody detects endogenous levels of total MAD2L1BP. |
MAD2L1BP Antibody |
1-CSB-PA013305GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MAD2L1BP Antibody |
1-CSB-PA246770 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
MAD2L1BP Antibody |
1-CSB-PA080033 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
MAD2L1BP Antibody |
1-CSB-PA083591 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MAD2L1BP. Recognizes MAD2L1BP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
Polyclonal MAD2L1BP antibody - N-terminal region |
APR01476G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAD2L1BP - N-terminal region. This antibody is tested and proven to work in the following applications: |
MAD2L1BP Conjugated Antibody |
C34774 |
SAB |
100ul |
EUR 397 |
anti- MAD2L1BP antibody |
FNab04925 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: MAD2L1 binding protein
- Uniprot ID: Q15013
- Gene ID: 9587
- Research Area: Cell Division and Proliferation
|
Description: Antibody raised against MAD2L1BP |
Anti-MAD2L1BP antibody |
STJ93984 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MAD2L1BP. |
MAD2L1BP siRNA |
20-abx923262 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MAD2L1BP siRNA |
20-abx923263 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-MAD2L1BP/Mad2L1 Binding Protein Rabbit Monoclonal Antibody |
M06825 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal MAD2L1BP/Mad2L1 Binding Protein Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
MAD2L1BP Blocking Peptide |
20-abx063600 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MAD2L1BP Blocking Peptide |
33R-8289 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAD2L1BP antibody, catalog no. 70R-10299 |
MAD2L1BP Blocking Peptide |
DF4150-BP |
Affbiotech |
1mg |
EUR 195 |
MAD2L1BP cloning plasmid |
CSB-CL624009HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 825
- Sequence: atggcggcgccggaggcggaggttctgtcctcagccgcagtccctgatttggagtggtatgagaagtccgaagaaactcacgcctcccagatagaactacttgagacaagctctacgcaggaacctctcaacgcttcggaggccttttgcccaagagactgcatggtaccagtggt
- Show more
|
Description: A cloning plasmid for the MAD2L1BP gene. |
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
20-abx113579 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
abx145442-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
20-abx008407 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
20-abx014567 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
abx028995-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
abx028995-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
20-abx323503 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
abx331264-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
abx234925-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
20-abx211247 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MAD2L1 Binding Protein (MAD2L1BP) Antibody |
20-abx210242 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse MAD2L1BP shRNA Plasmid |
20-abx975686 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MAD2L1BP shRNA Plasmid |
20-abx956381 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MAD2L1BP protein (His tag) |
80R-2185 |
Fitzgerald |
50 ug |
EUR 322 |
Description: Purified recombinant Human MAD2L1BP protein (His tag) |
MAD2L1BP Recombinant Protein (Human) |
RP018568 |
ABM |
100 ug |
Ask for price |
MAD2L1BP Recombinant Protein (Rat) |
RP210506 |
ABM |
100 ug |
Ask for price |
MAD2L1BP Recombinant Protein (Mouse) |
RP148898 |
ABM |
100 ug |
Ask for price |
Anti-MAD2L1BP/Mad2L1 Binding Protein Antibody |
A06825 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal MAD2L1BP/Mad2L1 Binding Protein Antibody. Validated in WB and tested in Human. |
Monoclonal MAD2L1BP Antibody (monoclonal) (M03), Clone: 4G11 |
AMM03758G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human MAD2L1BP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4G11. This antibody is applicable in WB and IF, E |
MAD2L1BP ORF Vector (Human) (pORF) |
ORF006190 |
ABM |
1.0 ug DNA |
EUR 95 |
Mad2l1bp ORF Vector (Mouse) (pORF) |
ORF049634 |
ABM |
1.0 ug DNA |
EUR 506 |
Mad2l1bp ORF Vector (Rat) (pORF) |
ORF070170 |
ABM |
1.0 ug DNA |
EUR 506 |
MAD2L1BP sgRNA CRISPR Lentivector set (Human) |
K1251501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mad2l1bp sgRNA CRISPR Lentivector set (Mouse) |
K4086901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mad2l1bp sgRNA CRISPR Lentivector set (Rat) |
K7461601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mouse MAD2L1- binding protein, Mad2l1bp ELISA KIT |
ELI-19587m |
Lifescience Market |
96 Tests |
EUR 865 |
Human MAD2L1- binding protein, MAD2L1BP ELISA KIT |
ELI-42959h |
Lifescience Market |
96 Tests |
EUR 824 |
Human MAD2L1 Binding Protein (MAD2L1BP) ELISA Kit |
abx388370-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
MAD2L1BP sgRNA CRISPR Lentivector (Human) (Target 1) |
K1251502 |
ABM |
1.0 ug DNA |
EUR 154 |
MAD2L1BP sgRNA CRISPR Lentivector (Human) (Target 2) |
K1251503 |
ABM |
1.0 ug DNA |
EUR 154 |
MAD2L1BP sgRNA CRISPR Lentivector (Human) (Target 3) |
K1251504 |
ABM |
1.0 ug DNA |
EUR 154 |
Mad2l1bp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4086902 |
ABM |
1.0 ug DNA |
EUR 154 |
Mad2l1bp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4086903 |
ABM |
1.0 ug DNA |
EUR 154 |
Mad2l1bp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4086904 |
ABM |
1.0 ug DNA |
EUR 154 |
Mad2l1bp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7461602 |
ABM |
1.0 ug DNA |
EUR 154 |
Mad2l1bp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7461603 |
ABM |
1.0 ug DNA |
EUR 154 |
Mad2l1bp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7461604 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human MAD2L1BP Protein, His, E.coli-10ug |
QP12617-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human MAD2L1BP Protein, His, E.coli-1mg |
QP12617-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human MAD2L1BP Protein, His, E.coli-2ug |
QP12617-2ug |
EnQuireBio |
2ug |
EUR 155 |
MAD2L1BP Protein Vector (Rat) (pPB-C-His) |
PV280678 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP Protein Vector (Rat) (pPB-N-His) |
PV280679 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP Protein Vector (Rat) (pPM-C-HA) |
PV280680 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP Protein Vector (Rat) (pPM-C-His) |
PV280681 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP MAD2L1 Binding Protein Human Recombinant Protein |
PROTQ15013 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: MAD2L1BP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 298 amino acids (1-274 a.a) and having a molecular mass of 33.6kDa (Molecular weight on SDS-PAGE will appear higher).;MAD2L1BP is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
MAD2L1BP Protein Vector (Human) (pPB-C-His) |
PV024757 |
ABM |
500 ng |
EUR 329 |
MAD2L1BP Protein Vector (Human) (pPB-N-His) |
PV024758 |
ABM |
500 ng |
EUR 329 |
MAD2L1BP Protein Vector (Human) (pPM-C-HA) |
PV024759 |
ABM |
500 ng |
EUR 329 |
MAD2L1BP Protein Vector (Human) (pPM-C-His) |
PV024760 |
ABM |
500 ng |
EUR 329 |
MAD2L1BP Protein Vector (Mouse) (pPB-C-His) |
PV198534 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP Protein Vector (Mouse) (pPB-N-His) |
PV198535 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP Protein Vector (Mouse) (pPM-C-HA) |
PV198536 |
ABM |
500 ng |
EUR 603 |
MAD2L1BP Protein Vector (Mouse) (pPM-C-His) |
PV198537 |
ABM |
500 ng |
EUR 603 |
Mad2l1bp 3'UTR GFP Stable Cell Line |
TU162779 |
ABM |
1.0 ml |
Ask for price |
Mad2l1bp 3'UTR Luciferase Stable Cell Line |
TU212743 |
ABM |
1.0 ml |
Ask for price |
MAD2L1BP 3'UTR Luciferase Stable Cell Line |
TU012833 |
ABM |
1.0 ml |
EUR 1521 |
Mad2l1bp 3'UTR Luciferase Stable Cell Line |
TU112779 |
ABM |
1.0 ml |
Ask for price |
MAD2L1BP 3'UTR GFP Stable Cell Line |
TU062833 |
ABM |
1.0 ml |
EUR 1521 |
Mad2l1bp 3'UTR GFP Stable Cell Line |
TU262743 |
ABM |
1.0 ml |
Ask for price |
MAD2L1BP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV637279 |
ABM |
1.0 ug DNA |
EUR 514 |