Order Now: brent@sdlifesciences.com
 LDHD Polyclonal Antibody |
|
EA126-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA |
LDHD Polyclonal Antibody |
|
EA126-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA |
LDHD Polyclonal Antibody |
|
A65962 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
LDHD Polyclonal Antibody |
|
ABP57154-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
LDHD Polyclonal Antibody |
|
ABP57154-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
LDHD Polyclonal Antibody |
|
ABP57154-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
LDHD Polyclonal Antibody |
|
ES8153-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA |
LDHD Polyclonal Antibody |
|
ES8153-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA |
 ELISA Kit) Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
DLR-LDHD-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
DLR-LDHD-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
RDR-LDHD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
RDR-LDHD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
RD-LDHD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
RD-LDHD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 LDHD Rabbit pAb |
|
A15965-100ul |
Abclonal |
100 ul |
EUR 308 |
LDHD Rabbit pAb |
|
A15965-200ul |
Abclonal |
200 ul |
EUR 459 |
LDHD Rabbit pAb |
|
A15965-20ul |
Abclonal |
20 ul |
EUR 183 |
LDHD Rabbit pAb |
|
A15965-50ul |
Abclonal |
50 ul |
EUR 223 |
LDHD Rabbit pAb |
|
A5196-100ul |
Abclonal |
100 ul |
EUR 308 |
LDHD Rabbit pAb |
|
A5196-200ul |
Abclonal |
200 ul |
EUR 459 |
LDHD Rabbit pAb |
|
A5196-20ul |
Abclonal |
20 ul |
Ask for price |
LDHD Rabbit pAb |
|
A5196-50ul |
Abclonal |
50 ul |
Ask for price |
 LDHD antibody |
|
70R-18240 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal LDHD antibody |
 LDHD Antibody |
|
43520-100ul |
SAB |
100ul |
EUR 252 |
 LDHD Antibody |
|
43877-100ul |
SAB |
100ul |
EUR 252 |
LDHD Antibody |
|
1-CSB-PA080118 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
|
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000-5000 |
LDHD Antibody |
|
1-CSB-PA801250LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
LDHD antibody |
|
70R-3502 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal LDHD antibody raised against the middle region of LDHD |
LDHD Antibody |
|
1-CSB-PA012845GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
) Polyclonal LDHD Antibody (N-term) |
|
APR05672G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDHD (N-term). This antibody is tested and proven to work in the following applications: |
 LDHD Polyclonal Antibody, HRP Conjugated |
|
A65963 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 LDHD Polyclonal Antibody, FITC Conjugated |
|
A65964 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 LDHD Polyclonal Antibody, Biotin Conjugated |
|
A65965 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 LDHD Conjugated Antibody |
|
C43520 |
SAB |
100ul |
EUR 397 |
 LDHD Conjugated Antibody |
|
C43877 |
SAB |
100ul |
EUR 397 |
 anti- LDHD antibody |
|
FNab04741 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: lactate dehydrogenase D
- Uniprot ID: Q86WU2
- Gene ID: 197257
- Research Area: Metabolism
|
|
Description: Antibody raised against LDHD |
 Anti-LDHD antibody |
|
STJ111240 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. |
Anti-LDHD antibody |
|
STJ97199 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to LDHD. |
 Polyclonal Antibody (Human)) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human) |
|
4-PAE130Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD) |
 LDHD siRNA |
|
20-abx922391 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LDHD siRNA |
|
20-abx922392 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-LDHD |
|
YF-PA22659 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to LDHD |
anti-LDHD |
|
YF-PA22660 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to LDHD |
 LDHD Antibody, HRP conjugated |
|
1-CSB-PA801250LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 LDHD Antibody, FITC conjugated |
|
1-CSB-PA801250LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 LDHD Antibody, Biotin conjugated |
|
1-CSB-PA801250LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Polyclonal Antibody (Human), APC) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), APC |
|
4-PAE130Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), Biotinylated |
|
4-PAE130Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), Cy3 |
|
4-PAE130Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), FITC |
|
4-PAE130Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), HRP |
|
4-PAE130Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), PE |
|
4-PAE130Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with PE. |
 ELISA Kit) Rabbit Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx362813-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 LDHD Blocking Peptide |
|
33R-5196 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDHD antibody, catalog no. 70R-3502 |
 LDHD cloning plasmid |
|
CSB-CL801250HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1524
- Sequence: atggcccgactgctcaggtctgcaacctgggagctgttcccctggaggggctactgctcccagaaggcaaagggagagctctgcagggacttcgtagaggctctgaaggccgtggtgggcggctcccacgtgtccactgccgcggtggtccgagagcagcacgggcgcgatgagt
- Show more
|
|
Description: A cloning plasmid for the LDHD gene. |
 Antibody) Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx113429 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx126961 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx128330 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx134538 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
abx145634-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx173292 |
Abbexa |
|
|
|
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
abx032602-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
abx032602-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
abx234741-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx326977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lactate Dehydrogenase D (LDHD) Antibody |
|
20-abx318606 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAE130Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LDHD (Arg62~Ala265)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with APC-Cy7. |
 Antibody (HRP)) Lactate Dehydrogenase D (LDHD) Antibody (HRP) |
|
20-abx308426 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Lactate Dehydrogenase D (LDHD) Antibody (FITC) |
|
20-abx308427 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Lactate Dehydrogenase D (LDHD) Antibody (Biotin) |
|
20-abx308428 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Human LDHD shRNA Plasmid |
|
20-abx966195 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse LDHD shRNA Plasmid |
|
20-abx974287 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) LDHD Recombinant Protein (Human) |
|
RP017650 |
ABM |
100 ug |
Ask for price |
) LDHD Recombinant Protein (Rat) |
|
RP207959 |
ABM |
100 ug |
Ask for price |
) LDHD Recombinant Protein (Mouse) |
|
RP147164 |
ABM |
100 ug |
Ask for price |
 Rat LDHD ELISA Kit |
|
STJ150057 |
St John's Laboratory |
1 kit |
EUR 412 |
|
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of D-LDH in Rat serum, plasma and other biological fluids |
 (pORF)) Ldhd ORF Vector (Rat) (pORF) |
|
ORF069321 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) LDHD ORF Vector (Human) (pORF) |
|
ORF005884 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Ldhd ORF Vector (Mouse) (pORF) |
|
ORF049056 |
ABM |
1.0 ug DNA |
EUR 506 |
) Recombinant Lactate Dehydrogenase D (LDHD) |
|
4-RPE130Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q86WU2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.9kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Lactate Dehydrogenase D expressed in: E.coli |
 (OKCA02374)) LDHD ELISA Kit (Mouse) (OKCA02374) |
|
OKCA02374 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.17 mU/mL |
 (OKCD08603)) LDHD ELISA Kit (Human) (OKCD08603) |
|
OKCD08603 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: The exact functions of LDHD remain unknown.The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL |
 (OKEH01221)) LDHD ELISA Kit (Human) (OKEH01221) |
|
OKEH01221 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL |
 (OKEH05369)) LDHD ELISA Kit (Mouse) (OKEH05369) |
|
OKEH05369 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/mL |
 Protein) Human Lactate Dehydrogenase D (LDHD) Protein |
|
20-abx168150 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) Ldhd sgRNA CRISPR Lentivector set (Rat) |
|
K6101501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ldhd sgRNA CRISPR Lentivector set (Mouse) |
|
K3138201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) LDHD sgRNA CRISPR Lentivector set (Human) |
|
K1205801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx053234-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-10 working days.
|
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
20-abx152182 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Mouse Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx255322-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx256875-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Sheep Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx257102-96tests |
Abbexa |
96 tests |
EUR 864 |
- Shipped within 5-12 working days.
|
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx252339-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx359717-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx361256-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
abx356517-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 CLIA Kit) Human Lactate Dehydrogenase D (LDHD) CLIA Kit |
|
20-abx494510 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 (Target 1)) Ldhd sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6101502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ldhd sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6101503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ldhd sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6101504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3138202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3138203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3138204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) LDHD sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1205802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) LDHD sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1205803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) LDHD sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1205804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) LDHD Protein Vector (Human) (pPB-C-His) |
|
PV023533 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) LDHD Protein Vector (Human) (pPB-N-His) |
|
PV023534 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) LDHD Protein Vector (Human) (pPM-C-HA) |
|
PV023535 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) LDHD Protein Vector (Human) (pPM-C-His) |
|
PV023536 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) LDHD Protein Vector (Rat) (pPB-C-His) |
|
PV277282 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) LDHD Protein Vector (Rat) (pPB-N-His) |
|
PV277283 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) LDHD Protein Vector (Rat) (pPM-C-HA) |
|
PV277284 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) LDHD Protein Vector (Rat) (pPM-C-His) |
|
PV277285 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) LDHD Protein Vector (Mouse) (pPB-C-His) |
|
PV196222 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) LDHD Protein Vector (Mouse) (pPB-N-His) |
|
PV196223 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) LDHD Protein Vector (Mouse) (pPM-C-HA) |
|
PV196224 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) LDHD Protein Vector (Mouse) (pPM-C-His) |
|
PV196225 |
ABM |
500 ng |
EUR 603 |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
SEE130Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
SEE130Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
SEE130Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
SEE130Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids. |
Human Lactate Dehydrogenase D (LDHD) ELISA Kit |
|
4-SEE130Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lactate Dehydrogenase D elisa. Alternative names of the recognized antigen: LDH-D
- DLD
- Probable D-lactate dehydrogenase, mitochondrial
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lactate Dehydrogenase D (LDHD) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Ldhd 3'UTR Luciferase Stable Cell Line |
|
TU110977 |
ABM |
1.0 ml |
Ask for price |
 Ldhd 3'UTR GFP Stable Cell Line |
|
TU160977 |
ABM |
1.0 ml |
Ask for price |
Ldhd 3'UTR Luciferase Stable Cell Line |
|
TU206998 |
ABM |
1.0 ml |
Ask for price |
Ldhd 3'UTR GFP Stable Cell Line |
|
TU256998 |
ABM |
1.0 ml |
Ask for price |
 LDHD 3'UTR GFP Stable Cell Line |
|
TU062362 |
ABM |
1.0 ml |
EUR 1394 |
 LDHD 3'UTR Luciferase Stable Cell Line |
|
TU012362 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
