Order Now: brent@sdlifesciences.com
KCNN4 (SK4) Polyclonal Antibody |
ES8331-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against KCNN4 (SK4) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
KCNN4 (SK4) Polyclonal Antibody |
ABP57338-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNN4 SK4) from Human, Mouse, Rat. This KCNN4 SK4) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
KCNN4 (SK4) Polyclonal Antibody |
ABP57338-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNN4 SK4) from Human, Mouse, Rat. This KCNN4 SK4) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
KCNN4 (SK4) Polyclonal Antibody |
ABP57338-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNN4 SK4) from Human, Mouse, Rat. This KCNN4 SK4) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
Anti-KCNN4 (SK4) antibody |
STJ97585 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to KCNN4 (SK4) (A247). |
KCNN4 Rabbit pAb |
A1974-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNN4 Rabbit pAb |
A1974-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNN4 Rabbit pAb |
A1974-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNN4 Rabbit pAb |
A1974-50ul |
Abclonal |
50 ul |
EUR 223 |
KCNN4 antibody |
70R-5153 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KCNN4 antibody raised against the C terminal of KCNN4 |
KCNN4 antibody |
70R-36033 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal KCNN4 antibody |
KCNN4 Antibody |
32529-100ul |
SAB |
100ul |
EUR 252 |
KCNN4 Antibody |
DF6727 |
Affbiotech |
200ul |
EUR 304 |
Description: KCNN4 Antibody detects endogenous levels of total KCNN4. |
KCNN4 Antibody |
1-CSB-PA980762 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
KCNN4 Antibody |
DF4132 |
Affbiotech |
200ul |
EUR 304 |
Description: KCNN4 Antibody detects endogenous levels of total KCNN4. |
KCNN4 Antibody |
1-CSB-PA012086ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
KCNN4 Antibody |
1-CSB-PA012086ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
KCNN4 Antibody |
1-CSB-PA484256 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
KCNN4 Antibody |
1-CSB-PA009613 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
Monoclonal KCa3.1 (SK4) (extracellular) Antibody |
AMM06066G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human KCa3.1 (SK4) (extracellular). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC, FC, ICC |
Polyclonal KCNN4 / KCa3.1 Antibody (aa227-239) |
AMM06148G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KCNN4 / KCa3.1 (aa227-239). This antibody is tested and proven to work in the following applications: |
Polyclonal KCNN4 / KCa3.1 Antibody (C-Terminus) |
AMM06149G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN4 / KCa3.1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal KCNN4 / KCa3.1 Antibody (N-Terminus) |
AMM06150G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN4 / KCa3.1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal KCNN4 antibody - C-terminal region |
AMM06151G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN4 - C-terminal region. This antibody is tested and proven to work in the following applications: |
anti- KCNN4 antibody |
FNab04498 |
FN Test |
100µg |
EUR 585 |
- Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
- Uniprot ID: O15554
- Gene ID: 3783
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against KCNN4 |
anti- KCNN4 antibody |
FNab04499 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
- Uniprot ID: O15554
- Gene ID: 3783
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against KCNN4 |
Anti-KCNN4 Antibody |
A01936-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-KCNN4 Antibody |
PA1047-1 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-KCNN4 antibody |
STJ24298 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. |
KCNN4 siRNA |
20-abx921302 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN4 siRNA |
20-abx921303 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-KCNN4 |
YF-PA27273 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to KCNN4 |
anti-KCNN4 |
YF-PA27274 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to KCNN4 |
KCNN4 cloning plasmid |
CSB-CL012086HU-10ug |
Cusabio |
10ug |
EUR 469 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1284
- Sequence: atgggcggggatctggtgcttggcctgggggccttgagacgccgaaagcgcttgctggagcaggagaagtctctggccggctgggcactggtgctggcaggaactggcattggactcatggtgctgcatgcagagatgctgtggttcggggggtgctcgtgggcgctctacctgt
- Show more
|
Description: A cloning plasmid for the KCNN4 gene. |
KCNN4 Blocking Peptide |
33R-2063 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN4 antibody, catalog no. 70R-5153 |
KCNN4 Blocking Peptide |
DF6727-BP |
Affbiotech |
1mg |
EUR 195 |
KCNN4 Blocking Peptide |
DF4132-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant human KCNN4 |
P1125 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: O15554
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human KCNN4 |
Mouse KCNN4 shRNA Plasmid |
20-abx971166 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human KCNN4 shRNA Plasmid |
20-abx952557 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KCNN4 Recombinant Protein (Human) |
RP016666 |
ABM |
100 ug |
Ask for price |
KCNN4 Recombinant Protein (Rat) |
RP206936 |
ABM |
100 ug |
Ask for price |
KCNN4 Recombinant Protein (Mouse) |
RP145310 |
ABM |
100 ug |
Ask for price |
KCNN4 Recombinant Protein (Mouse) |
RP145313 |
ABM |
100 ug |
Ask for price |
KCNN4 ORF Vector (Human) (pORF) |
ORF005556 |
ABM |
1.0 ug DNA |
EUR 95 |
Kcnn4 ORF Vector (Rat) (pORF) |
ORF068980 |
ABM |
1.0 ug DNA |
EUR 506 |
h KCNN4 inducible lentiviral particles |
LVP516 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made optional inducible lentiviral particles for expressing human target: KCNN4 (alternative name: IK1, IKCA1, KCA4, KCa3.1, SK4, hIKCa1, hKCa4, hSK4). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_002250.2. Particles also contains a RFP-Blasticidin dual selection marker. |
CFP-KCNN4 fusion lentiviral particles |
LVP551-C |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made lentiviral particles expressing afusion target of (CFP-human CLCN2), provided in DMEM medium with 10% FBS and 60ug/ml of polybrene. |
RFP-KCNN4 fusion lentiviral particles |
LVP551-R |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made lentiviral particles expressing afusion target of (RFP-human CLCN2), provided in DMEM medium with 10% FBS and 60ug/ml of polybrene. |
Kcnn4 ORF Vector (Mouse) (pORF) |
ORF048438 |
ABM |
1.0 ug DNA |
EUR 506 |
Kcnn4 ORF Vector (Mouse) (pORF) |
ORF048439 |
ABM |
1.0 ug DNA |
EUR 506 |
KCNN4 sgRNA CRISPR Lentivector set (Human) |
K1124401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcnn4 sgRNA CRISPR Lentivector set (Mouse) |
K3793001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcnn4 sgRNA CRISPR Lentivector set (Rat) |
K7624001 |
ABM |
3 x 1.0 ug |
EUR 339 |
KCNN4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1124402 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNN4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1124403 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNN4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1124404 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3793002 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3793003 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3793004 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7624002 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7624003 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7624004 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNN4 Protein Vector (Human) (pPB-C-His) |
PV022221 |
ABM |
500 ng |
EUR 329 |
KCNN4 Protein Vector (Human) (pPB-N-His) |
PV022222 |
ABM |
500 ng |
EUR 329 |
KCNN4 Protein Vector (Human) (pPM-C-HA) |
PV022223 |
ABM |
500 ng |
EUR 329 |
KCNN4 Protein Vector (Human) (pPM-C-His) |
PV022224 |
ABM |
500 ng |
EUR 329 |
KCNN4 Protein Vector (Rat) (pPB-C-His) |
PV275918 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Rat) (pPB-N-His) |
PV275919 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Rat) (pPM-C-HA) |
PV275920 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Rat) (pPM-C-His) |
PV275921 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPB-C-His) |
PV193750 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPB-N-His) |
PV193751 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPM-C-HA) |
PV193752 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPM-C-His) |
PV193753 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPB-C-His) |
PV193754 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPB-N-His) |
PV193755 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPM-C-HA) |
PV193756 |
ABM |
500 ng |
EUR 603 |
KCNN4 Protein Vector (Mouse) (pPM-C-His) |
PV193757 |
ABM |
500 ng |
EUR 603 |
Kcnn4 3'UTR Luciferase Stable Cell Line |
TU206612 |
ABM |
1.0 ml |
Ask for price |
Kcnn4 3'UTR GFP Stable Cell Line |
TU160467 |
ABM |
1.0 ml |
Ask for price |
KCNN4 3'UTR Luciferase Stable Cell Line |
TU011537 |
ABM |
1.0 ml |
EUR 1394 |
Kcnn4 3'UTR Luciferase Stable Cell Line |
TU110467 |
ABM |
1.0 ml |
Ask for price |
KCNN4 3'UTR GFP Stable Cell Line |
TU061537 |
ABM |
1.0 ml |
EUR 1394 |
Kcnn4 3'UTR GFP Stable Cell Line |
TU256612 |
ABM |
1.0 ml |
Ask for price |
KCNN4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV654055 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNN4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV654059 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNN4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV654060 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |