Order Now: brent@sdlifesciences.com
 Polyclonal Antibody) KCNN3 (SK3) Polyclonal Antibody |
|
ABP57337-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
|
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
KCNN3 (SK3) Polyclonal Antibody |
|
ES8330-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against KCNN3 (SK3) from Human/Rat. This antibody is tested and validated for IHC |
KCNN3 (SK3) Polyclonal Antibody |
|
ES8330-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against KCNN3 (SK3) from Human/Rat. This antibody is tested and validated for IHC |
 Antibody) Anti-KCNN3 (SK3) Antibody |
|
A03865 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal Antibody for KCNN3 (SK3) Antibody (KCNN3) detection. Tested with IHC in Human, Rat. |
 antibody) Anti-KCNN3 (SK3) antibody |
|
STJ97584 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to KCNN3 (SK3) (A246). |
 KCNN3 Rabbit pAb |
|
A14012-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNN3 Rabbit pAb |
|
A14012-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNN3 Rabbit pAb |
|
A14012-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNN3 Rabbit pAb |
|
A14012-50ul |
Abclonal |
50 ul |
EUR 223 |
KCNN3 Rabbit pAb |
|
A6125-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNN3 Rabbit pAb |
|
A6125-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNN3 Rabbit pAb |
|
A6125-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNN3 Rabbit pAb |
|
A6125-50ul |
Abclonal |
50 ul |
EUR 223 |
 KCNN3 antibody |
|
70R-1524 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3 |
KCNN3 antibody |
|
38722-100ul |
SAB |
100ul |
EUR 252 |
 KCNN3 Antibody |
|
1-CSB-PA838540 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
|
|
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200 |
KCNN3 Antibody |
|
1-CSB-PA880079LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
KCNN3 antibody |
|
70R-5182 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3 |
 Polyclonal KCNN3 antibody - C-terminal region |
|
AMM06147G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN3 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 KCNN3 Conjugated Antibody |
|
C38722 |
SAB |
100ul |
EUR 397 |
 anti- KCNN3 antibody |
|
FNab04497 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IF: 1:50-1:100
- Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
- Uniprot ID: Q9UGI6
- Gene ID: 3782
- Research Area: Neuroscience, Developmental biology
|
|
Description: Antibody raised against KCNN3 |
 Anti-KCNN3 antibody |
|
STJ27878 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-KCNN3 antibody |
|
STJ115947 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
 KCNN3 siRNA |
|
20-abx902817 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN3 siRNA |
|
20-abx921300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN3 siRNA |
|
20-abx921301 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-KCNN3 |
|
YF-PA24045 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to KCNN3 |
 KCNN3 Antibody, HRP conjugated |
|
1-CSB-PA880079LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 KCNN3 Antibody, FITC conjugated |
|
1-CSB-PA880079LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 KCNN3 Antibody, Biotin conjugated |
|
1-CSB-PA880079LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Anti-CD4 Antibody [SK3], APC-100Tests |
|
QAB10-APC-100Tests |
EnQuireBio |
100Tests |
EUR 462 |
 Anti-CD4 Antibody [SK3], APC-25Tests |
|
QAB10-APC-25Tests |
EnQuireBio |
25Tests |
EUR 242 |
 Anti-CD4 Antibody [SK3], APC-500Tests |
|
QAB10-APC-500Tests |
EnQuireBio |
500Tests |
EUR 1824 |
 Anti-CD4 Antibody [SK3], FITC-100Tests |
|
QAB10-F-100Tests |
EnQuireBio |
100Tests |
EUR 343 |
 Anti-CD4 Antibody [SK3], FITC-25Tests |
|
QAB10-F-25Tests |
EnQuireBio |
25Tests |
EUR 216 |
 Anti-CD4 Antibody [SK3], FITC-500Tests |
|
QAB10-F-500Tests |
EnQuireBio |
500Tests |
EUR 1308 |
 Anti-CD4 Antibody [SK3], PerCP-100Tests |
|
QAB10-PCP-100Tests |
EnQuireBio |
100Tests |
EUR 487 |
 Anti-CD4 Antibody [SK3], PerCP-25Tests |
|
QAB10-PCP-25Tests |
EnQuireBio |
25Tests |
EUR 225 |
 Anti-CD4 Antibody [SK3], PerCP-500Tests |
|
QAB10-PCP-500Tests |
EnQuireBio |
500Tests |
EUR 1909 |
 KCNN3 Blocking Peptide |
|
33R-2149 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-1524 |
KCNN3 Blocking Peptide |
|
33R-4172 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-5182 |
 KCNN3 cloning plasmid |
|
CSB-CL880079HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1281
- Sequence: atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcc
- Show more
|
|
Description: A cloning plasmid for the KCNN3 gene. |
 Anti-CD4 Antibody [SK3], PerCP-Cy5.5-100Tests |
|
QAB10-PCP55-100Tests |
EnQuireBio |
100Tests |
EUR 555 |
 Anti-CD4 Antibody [SK3], PerCP-Cy5.5-25Tests |
|
QAB10-PCP55-25Tests |
EnQuireBio |
25Tests |
EUR 259 |
 Anti-CD4 Antibody [SK3], PerCP-Cy5.5-500Tests |
|
QAB10-PCP55-500Tests |
EnQuireBio |
500Tests |
EUR 2188 |
 Anti-CD4 Antibody [SK3], PE-Cy7-100Tests |
|
QAB10-PE7-100Tests |
EnQuireBio |
100Tests |
EUR 420 |
 Anti-CD4 Antibody [SK3], PE-Cy7-25Tests |
|
QAB10-PE7-25Tests |
EnQuireBio |
25Tests |
EUR 242 |
 Anti-CD4 Antibody [SK3], PE-Cy7-500Tests |
|
QAB10-PE7-500Tests |
EnQuireBio |
500Tests |
EUR 1647 |
 Rat KCNN3 shRNA Plasmid |
|
20-abx985806 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human KCNN3 shRNA Plasmid |
|
20-abx952556 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse KCNN3 shRNA Plasmid |
|
20-abx980249 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) KCNN3 Recombinant Protein (Human) |
|
RP016663 |
ABM |
100 ug |
Ask for price |
) KCNN3 Recombinant Protein (Rat) |
|
RP206933 |
ABM |
100 ug |
Ask for price |
) KCNN3 Recombinant Protein (Mouse) |
|
RP145307 |
ABM |
100 ug |
Ask for price |
 (pORF)) Kcnn3 ORF Vector (Rat) (pORF) |
|
ORF068979 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) KCNN3 ORF Vector (Human) (pORF) |
|
ORF005555 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Kcnn3 ORF Vector (Mouse) (pORF) |
|
ORF048437 |
ABM |
1.0 ug DNA |
EUR 506 |
) Kcnn3 sgRNA CRISPR Lentivector set (Rat) |
|
K6932301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Kcnn3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4060001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) KCNN3 sgRNA CRISPR Lentivector set (Human) |
|
K1124301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6932302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6932303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6932304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4060002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4060003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4060004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) KCNN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1124302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) KCNN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1124303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) KCNN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1124304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) KCNN3 Protein Vector (Human) (pPB-C-His) |
|
PV022217 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) KCNN3 Protein Vector (Human) (pPB-N-His) |
|
PV022218 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) KCNN3 Protein Vector (Human) (pPM-C-HA) |
|
PV022219 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) KCNN3 Protein Vector (Human) (pPM-C-His) |
|
PV022220 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) KCNN3 Protein Vector (Rat) (pPB-C-His) |
|
PV275914 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) KCNN3 Protein Vector (Rat) (pPB-N-His) |
|
PV275915 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) KCNN3 Protein Vector (Rat) (pPM-C-HA) |
|
PV275916 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) KCNN3 Protein Vector (Rat) (pPM-C-His) |
|
PV275917 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) KCNN3 Protein Vector (Mouse) (pPB-C-His) |
|
PV193746 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) KCNN3 Protein Vector (Mouse) (pPB-N-His) |
|
PV193747 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) KCNN3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV193748 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) KCNN3 Protein Vector (Mouse) (pPM-C-His) |
|
PV193749 |
ABM |
500 ng |
EUR 1065 |
 Kcnn3 3'UTR Luciferase Stable Cell Line |
|
TU110466 |
ABM |
1.0 ml |
Ask for price |
 Kcnn3 3'UTR GFP Stable Cell Line |
|
TU160466 |
ABM |
1.0 ml |
Ask for price |
Kcnn3 3'UTR Luciferase Stable Cell Line |
|
TU206611 |
ABM |
1.0 ml |
Ask for price |
Kcnn3 3'UTR GFP Stable Cell Line |
|
TU256611 |
ABM |
1.0 ml |
Ask for price |
 KCNN3 3'UTR GFP Stable Cell Line |
|
TU061536 |
ABM |
1.0 ml |
EUR 1394 |
 KCNN3 3'UTR Luciferase Stable Cell Line |
|
TU011536 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) KCNN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV652327 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) KCNN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV652331 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) KCNN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV652332 |
ABM |
1.0 ug DNA |
EUR 1355 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
 MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
