KCNN3 (SK3) Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

KCNN3 (SK3) Polyclonal Antibody

ABP57337-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN3 (SK3) Polyclonal Antibody

ABP57337-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN3 (SK3) Polyclonal Antibody

ABP57337-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

Anti-KCNN3 (SK3) Antibody

A03865 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KCNN3 (SK3) Antibody (KCNN3) detection. Tested with IHC in Human, Rat.

Anti-KCNN3 (SK3) antibody

STJ97584 200 µl
EUR 197
Description: Rabbit polyclonal to KCNN3 (SK3) (A246).

KCNN3 Rabbit pAb

A6125-100ul 100 ul
EUR 308

KCNN3 Rabbit pAb

A6125-200ul 200 ul
EUR 459

KCNN3 Rabbit pAb

A6125-20ul 20 ul
EUR 183

KCNN3 Rabbit pAb

A6125-50ul 50 ul
EUR 223

KCNN3 Rabbit pAb

A14012-100ul 100 ul
EUR 308

KCNN3 Rabbit pAb

A14012-200ul 200 ul
EUR 459

KCNN3 Rabbit pAb

A14012-20ul 20 ul
EUR 183

KCNN3 Rabbit pAb

A14012-50ul 50 ul
EUR 223

KCNN3 antibody

70R-5182 50 ug
EUR 467
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3

KCNN3 antibody

38722-100ul 100ul
EUR 252

KCNN3 antibody

70R-1524 100 ug
EUR 377
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3

KCNN3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

KCNN3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200

Polyclonal KCNN3 antibody - C-terminal region

AMM06147G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Kcnn3/ Rat Kcnn3 ELISA Kit

ELI-15834r 96 Tests
EUR 886

KCNN3 Conjugated Antibody

C38722 100ul
EUR 397

anti- KCNN3 antibody

FNab04497 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:50-1:100
  • Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
  • Uniprot ID: Q9UGI6
  • Gene ID: 3782
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against KCNN3

Anti-KCNN3 antibody

PAab04497 100 ug
EUR 355

Anti-KCNN3 antibody

STJ27878 100 µl
EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-KCNN3 antibody

STJ115947 100 µl
EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24045 50 ul
EUR 334
Description: Mouse polyclonal to KCNN3

KCNN3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNN3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNN3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CD4 Antibody [SK3], APC-100Tests

QAB10-APC-100Tests 100Tests
EUR 462

Anti-CD4 Antibody [SK3], APC-25Tests

QAB10-APC-25Tests 25Tests
EUR 242

Anti-CD4 Antibody [SK3], APC-500Tests

QAB10-APC-500Tests 500Tests
EUR 1824

Anti-CD4 Antibody [SK3], FITC-100Tests

QAB10-F-100Tests 100Tests
EUR 343

Anti-CD4 Antibody [SK3], FITC-25Tests

QAB10-F-25Tests 25Tests
EUR 216

Anti-CD4 Antibody [SK3], FITC-500Tests

QAB10-F-500Tests 500Tests
EUR 1308

Anti-CD4 Antibody [SK3], PerCP-100Tests

QAB10-PCP-100Tests 100Tests
EUR 487

Anti-CD4 Antibody [SK3], PerCP-25Tests

QAB10-PCP-25Tests 25Tests
EUR 225

Anti-CD4 Antibody [SK3], PerCP-500Tests

QAB10-PCP-500Tests 500Tests
EUR 1909

KCNN3 Blocking Peptide

33R-4172 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-5182

KCNN3 Blocking Peptide

33R-2149 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-1524

KCNN3 cloning plasmid

CSB-CL880079HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcc
  • Show more
Description: A cloning plasmid for the KCNN3 gene.

Anti-CD4 Antibody [SK3], PerCP-Cy5.5-100Tests

QAB10-PCP55-100Tests 100Tests
EUR 555

Anti-CD4 Antibody [SK3], PerCP-Cy5.5-25Tests

QAB10-PCP55-25Tests 25Tests
EUR 259

Anti-CD4 Antibody [SK3], PerCP-Cy5.5-500Tests

QAB10-PCP55-500Tests 500Tests
EUR 2188

Anti-CD4 Antibody [SK3], PE-Cy7-100Tests

QAB10-PE7-100Tests 100Tests
EUR 420

Anti-CD4 Antibody [SK3], PE-Cy7-25Tests

QAB10-PE7-25Tests 25Tests
EUR 242

Anti-CD4 Antibody [SK3], PE-Cy7-500Tests

QAB10-PE7-500Tests 500Tests
EUR 1647

Mouse KCNN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat KCNN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-19466h 96 Tests
EUR 824


EF010463 96 Tests
EUR 689

Mouse Kcnn3 ELISA KIT

ELI-38264m 96 Tests
EUR 865

Human KCNN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KCNN3 Recombinant Protein (Human)

RP016663 100 ug Ask for price

KCNN3 Recombinant Protein (Rat)

RP206933 100 ug Ask for price

KCNN3 Recombinant Protein (Mouse)

RP145307 100 ug Ask for price

KCNN3 ORF Vector (Human) (pORF)

ORF005555 1.0 ug DNA
EUR 95

Kcnn3 ORF Vector (Rat) (pORF)

ORF068979 1.0 ug DNA
EUR 506

Kcnn3 ORF Vector (Mouse) (pORF)

ORF048437 1.0 ug DNA
EUR 506

pECMV-Kcnn3-m-FLAG Plasmid

PVT15008 2 ug
EUR 325

KCNN3 sgRNA CRISPR Lentivector set (Human)

K1124301 3 x 1.0 ug
EUR 339

Kcnn3 sgRNA CRISPR Lentivector set (Mouse)

K4060001 3 x 1.0 ug
EUR 339

Kcnn3 sgRNA CRISPR Lentivector set (Rat)

K6932301 3 x 1.0 ug
EUR 339

KCNN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1124302 1.0 ug DNA
EUR 154

KCNN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1124303 1.0 ug DNA
EUR 154

KCNN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1124304 1.0 ug DNA
EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4060002 1.0 ug DNA
EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4060003 1.0 ug DNA
EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4060004 1.0 ug DNA
EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6932302 1.0 ug DNA
EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6932303 1.0 ug DNA
EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6932304 1.0 ug DNA
EUR 154

KCNN3 Protein Vector (Human) (pPB-C-His)

PV022217 500 ng
EUR 329

KCNN3 Protein Vector (Human) (pPB-N-His)

PV022218 500 ng
EUR 329

KCNN3 Protein Vector (Human) (pPM-C-HA)

PV022219 500 ng
EUR 329

KCNN3 Protein Vector (Human) (pPM-C-His)

PV022220 500 ng
EUR 329

KCNN3 Protein Vector (Rat) (pPB-C-His)

PV275914 500 ng
EUR 1166

KCNN3 Protein Vector (Rat) (pPB-N-His)

PV275915 500 ng
EUR 1166

KCNN3 Protein Vector (Rat) (pPM-C-HA)

PV275916 500 ng
EUR 1166

KCNN3 Protein Vector (Rat) (pPM-C-His)

PV275917 500 ng
EUR 1166

KCNN3 Protein Vector (Mouse) (pPB-C-His)

PV193746 500 ng
EUR 1065

KCNN3 Protein Vector (Mouse) (pPB-N-His)

PV193747 500 ng
EUR 1065

KCNN3 Protein Vector (Mouse) (pPM-C-HA)

PV193748 500 ng
EUR 1065

KCNN3 Protein Vector (Mouse) (pPM-C-His)

PV193749 500 ng
EUR 1065

Kcnn3 3'UTR Luciferase Stable Cell Line

TU206611 1.0 ml Ask for price

Kcnn3 3'UTR GFP Stable Cell Line

TU160466 1.0 ml Ask for price

KCNN3 3'UTR Luciferase Stable Cell Line

TU011536 1.0 ml
EUR 1394

Kcnn3 3'UTR Luciferase Stable Cell Line

TU110466 1.0 ml Ask for price

KCNN3 3'UTR GFP Stable Cell Line

TU061536 1.0 ml
EUR 1394

Kcnn3 3'UTR GFP Stable Cell Line

TU256611 1.0 ml Ask for price

KCNN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV652327 1.0 ug DNA
EUR 1355

KCNN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV652331 1.0 ug DNA
EUR 1355

KCNN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV652332 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1