Order Now: brent@sdlifesciences.com
 Polyclonal Antibody) KCNN2 (SK2) Polyclonal Antibody |
|
ABP57336-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
|
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
KCNN2 (SK2) Polyclonal Antibody |
|
ES8329-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against KCNN2 (SK2) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
KCNN2 (SK2) Polyclonal Antibody |
|
ES8329-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against KCNN2 (SK2) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 antibody) Anti-KCNN2 (SK2) antibody |
|
STJ97583 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to KCNN2 (SK2) (A244). |
 Antibody) Polyclonal KCa2.2 (SK2) Antibody |
|
AMM06063G |
Leading Biology |
0.05ml |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCa2.2 (SK2) . This antibody is tested and proven to work in the following applications: |
 SK2 Antibody |
|
48406-100ul |
SAB |
100ul |
EUR 333 |
SK2 Antibody |
|
48406-50ul |
SAB |
50ul |
EUR 239 |
SK2 Antibody |
|
abx016183-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
 SK2 Conjugated Antibody |
|
C48406 |
SAB |
100ul |
EUR 397 |
 KCNN2 Rabbit pAb |
|
A10662-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNN2 Rabbit pAb |
|
A10662-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNN2 Rabbit pAb |
|
A10662-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNN2 Rabbit pAb |
|
A10662-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal KCNN2 Antibody (Internal) |
|
AMM06144G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KCNN2 (Internal). This antibody is tested and proven to work in the following applications: |
 KCNN2 antibody |
|
70R-1495 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal KCNN2 antibody raised against the C terminal of KCNN2 |
 KCNN2 Antibody |
|
47688-100ul |
SAB |
100ul |
EUR 252 |
KCNN2 Antibody |
|
1-CSB-PA285157 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
|
|
Description: A polyclonal antibody against KCNN2. Recognizes KCNN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB.IHC, ELISA;WB:1:1000-2000, IHC-p:1:100-200 |
KCNN2 antibody |
|
70R-5106 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal KCNN2 antibody raised against the middle region of KCNN2 |
KCNN2 Antibody |
|
20-abx326931 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Goat Anti-KCNN2 Antibody |
|
APR12123G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCNN2 . This antibody is tested and proven to work in the following applications: |
) Polyclonal KCNN2 Antibody (C-Terminus) |
|
AMM06143G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 (C-Terminus). This antibody is tested and proven to work in the following applications: |
 Polyclonal KCNN2 antibody - middle region |
|
AMM06146G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 - middle region. This antibody is tested and proven to work in the following applications: |
 Monoclonal SK2 Antibody, Clone: 9C5E1 |
|
APR09989G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human SK2. The antibodies are raised in Mouse and are from clone 9C5E1. This antibody is applicable in WB and IHC, FC, ICC, E |
 Monoclonal SK2 Antibody, Clone: 3C8D3 |
|
APR09990G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human SK2. The antibodies are raised in Mouse and are from clone 3C8D3. This antibody is applicable in WB and IHC, FC, ICC, E |
 Polyclonal KCNN2 antibody - C-terminal region |
|
AMM06145G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 KCNN2 Conjugated Antibody |
|
C47688 |
SAB |
100ul |
EUR 397 |
 Anti-KCNN2 antibody |
|
STJ118018 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. |
 ELISA Kit) Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
|
DLR-KCNN2-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
|
DLR-KCNN2-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
|
RDR-KCNN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
|
RDR-KCNN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
|
RD-KCNN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
|
RD-KCNN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
 Mating Factor a-SK2 |
|
H-4580.0001 |
Bachem |
1.0mg |
EUR 441 |
|
Description: Sum Formula: C81H106N18O19S; CAS# [89718-47-8] |
Mating Factor a-SK2 |
|
H-4580.0005 |
Bachem |
5.0mg |
EUR 1675 |
|
Description: Sum Formula: C81H106N18O19S; CAS# [89718-47-8] |
 KCNN2 siRNA |
|
20-abx902816 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN2 siRNA |
|
20-abx921298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN2 siRNA |
|
20-abx921299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 KCNN2 Blocking Peptide |
|
33R-3914 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN2 antibody, catalog no. 70R-1495 |
KCNN2 Blocking Peptide |
|
33R-4564 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN2 antibody, catalog no. 70R-5106 |
 KCNN2 cloning plasmid |
|
CSB-CL880957HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 696
- Sequence: atgtggttgatatcaataacttttctctccattggttatggtgacatggtacctaacacatactgtggaaaaggagtctgcttacttactggaattatgggtgctggttgcacagccctggtggtagctgtagtggcaaggaagctagaacttaccaaagcagaaaaacacgtgca
- Show more
|
|
Description: A cloning plasmid for the KCNN2 gene. |
KCNN2 cloning plasmid |
|
CSB-CL880957HU2-10ug |
Cusabio |
10ug |
EUR 597 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1740
- Sequence: atgagcagctgcaggtacaacgggggcgtcatgcggccgctcagcaacttgagcgcgtcccgccggaacctgcacgagatggactcagaggcgcagcccctgcagccccccgcgtctgtcggaggaggtggcggcgcgtcctccccgtctgcagccgctgccgccgccgccgctg
- Show more
|
|
Description: A cloning plasmid for the KCNN2 gene. |
 Rat KCNN2 shRNA Plasmid |
|
20-abx985805 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human KCNN2 shRNA Plasmid |
|
20-abx952555 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse KCNN2 shRNA Plasmid |
|
20-abx980248 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) KCNN2 Recombinant Protein (Human) |
|
RP016660 |
ABM |
100 ug |
Ask for price |
KCNN2 Recombinant Protein (Human) |
|
RP040261 |
ABM |
100 ug |
Ask for price |
) KCNN2 Recombinant Protein (Rat) |
|
RP206930 |
ABM |
100 ug |
Ask for price |
) KCNN2 Recombinant Protein (Mouse) |
|
RP145304 |
ABM |
100 ug |
Ask for price |
 Antibody) Small Conductance Calcium-Activated Potassium Channel Protein 2 (SK2) Antibody |
|
abx224215-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
 (pORF)) Kcnn2 ORF Vector (Rat) (pORF) |
|
ORF068978 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) KCNN2 ORF Vector (Human) (pORF) |
|
ORF005554 |
ABM |
1.0 ug DNA |
EUR 95 |
KCNN2 ORF Vector (Human) (pORF) |
|
ORF013421 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Kcnn2 ORF Vector (Mouse) (pORF) |
|
ORF048436 |
ABM |
1.0 ug DNA |
EUR 506 |
) KCNN2 Western Blot kit (AWBK35094) |
|
AWBK35094 |
Aviva Systems Biology |
10 reactions |
EUR 647 |
Description: - Description of target:
- Species reactivity:
- Application:
- Assay info:
- Sensitivity:
|
 (OKCD09271)) KCNN2 ELISA Kit (Human) (OKCD09271) |
|
OKCD09271 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
|
Description: Description of target: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by KCNN2 is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. KCNN2 is a member of the KCNN family of potassium channel genes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL |
 (OKDD00355)) KCNN2 ELISA Kit (Human) (OKDD00355) |
|
OKDD00355 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
|
Description: Description of target: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.081 ng/mL |
) Kcnn2 sgRNA CRISPR Lentivector set (Rat) |
|
K6854501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Kcnn2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4357101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) KCNN2 sgRNA CRISPR Lentivector set (Human) |
|
K1124201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6854502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6854503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6854504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4357102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4357103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4357104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) KCNN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1124202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) KCNN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1124203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) KCNN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1124204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) KCNN2 Protein Vector (Human) (pPB-C-His) |
|
PV022213 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) KCNN2 Protein Vector (Human) (pPB-N-His) |
|
PV022214 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) KCNN2 Protein Vector (Human) (pPM-C-HA) |
|
PV022215 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) KCNN2 Protein Vector (Human) (pPM-C-His) |
|
PV022216 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) KCNN2 Protein Vector (Rat) (pPB-C-His) |
|
PV275910 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) KCNN2 Protein Vector (Rat) (pPB-N-His) |
|
PV275911 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) KCNN2 Protein Vector (Rat) (pPM-C-HA) |
|
PV275912 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) KCNN2 Protein Vector (Rat) (pPM-C-His) |
|
PV275913 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) KCNN2 Protein Vector (Mouse) (pPB-C-His) |
|
PV193742 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) KCNN2 Protein Vector (Mouse) (pPB-N-His) |
|
PV193743 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) KCNN2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV193744 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) KCNN2 Protein Vector (Mouse) (pPM-C-His) |
|
PV193745 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Human) (pPB-C-His) |
|
PV053681 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPB-N-His) |
|
PV053682 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPM-C-HA) |
|
PV053683 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPM-C-His) |
|
PV053684 |
ABM |
500 ng |
EUR 481 |
 Kcnn2 3'UTR Luciferase Stable Cell Line |
|
TU110465 |
ABM |
1.0 ml |
Ask for price |
 Kcnn2 3'UTR GFP Stable Cell Line |
|
TU160465 |
ABM |
1.0 ml |
Ask for price |
Kcnn2 3'UTR Luciferase Stable Cell Line |
|
TU206610 |
ABM |
1.0 ml |
Ask for price |
Kcnn2 3'UTR GFP Stable Cell Line |
|
TU256610 |
ABM |
1.0 ml |
Ask for price |
 KCNN2 3'UTR GFP Stable Cell Line |
|
TU061535 |
ABM |
1.0 ml |
EUR 1394 |
 KCNN2 3'UTR Luciferase Stable Cell Line |
|
TU011535 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) KCNN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV685939 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) KCNN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV685943 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) KCNN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV685944 |
ABM |
1.0 ug DNA |
EUR 682 |
 (CMV) (pLenti-GIII-CMV)) KCNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV701817 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) KCNN2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV701821 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) KCNN2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV701822 |
ABM |
1.0 ug DNA |
EUR 450 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
