Order Now: brent@sdlifesciences.com
KCNN2 (SK2) Polyclonal Antibody |
ABP57336-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
KCNN2 (SK2) Polyclonal Antibody |
ABP57336-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
KCNN2 (SK2) Polyclonal Antibody |
ABP57336-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNN2 SK2) from Human, Mouse, Rat. This KCNN2 SK2) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
Anti-KCNN2 (SK2) antibody |
STJ97583 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to KCNN2 (SK2) (A244). |
Polyclonal KCa2.2 (SK2) Antibody |
AMM06063G |
Leading Biology |
0.05ml |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCa2.2 (SK2) . This antibody is tested and proven to work in the following applications: |
SK2 Antibody |
abx016183-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
SK2 Antibody |
48406-100ul |
SAB |
100ul |
EUR 333 |
SK2 Antibody |
48406-50ul |
SAB |
50ul |
EUR 239 |
SK2 Conjugated Antibody |
C48406 |
SAB |
100ul |
EUR 397 |
KCNN2 Rabbit pAb |
A10662-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNN2 Rabbit pAb |
A10662-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNN2 Rabbit pAb |
A10662-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNN2 Rabbit pAb |
A10662-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal KCNN2 Antibody (Internal) |
AMM06144G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KCNN2 (Internal). This antibody is tested and proven to work in the following applications: |
KCNN2 Antibody |
20-abx326931 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN2 antibody |
70R-5106 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KCNN2 antibody raised against the middle region of KCNN2 |
KCNN2 Antibody |
47688-100ul |
SAB |
100ul |
EUR 252 |
KCNN2 antibody |
70R-1495 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal KCNN2 antibody raised against the C terminal of KCNN2 |
KCNN2 Antibody |
1-CSB-PA285157 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against KCNN2. Recognizes KCNN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB.IHC, ELISA;WB:1:1000-2000, IHC-p:1:100-200 |
Polyclonal KCNN2 Antibody (C-Terminus) |
AMM06143G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal KCNN2 antibody - middle region |
AMM06146G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 - middle region. This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-KCNN2 Antibody |
APR12123G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCNN2 . This antibody is tested and proven to work in the following applications: |
Monoclonal SK2 Antibody, Clone: 9C5E1 |
APR09989G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human SK2. The antibodies are raised in Mouse and are from clone 9C5E1. This antibody is applicable in WB and IHC, FC, ICC, E |
Monoclonal SK2 Antibody, Clone: 3C8D3 |
APR09990G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human SK2. The antibodies are raised in Mouse and are from clone 3C8D3. This antibody is applicable in WB and IHC, FC, ICC, E |
Polyclonal KCNN2 antibody - C-terminal region |
AMM06145G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
KCNN2 Conjugated Antibody |
C47688 |
SAB |
100ul |
EUR 397 |
Anti-KCNN2 antibody |
STJ118018 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
DLR-KCNN2-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
DLR-KCNN2-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
RD-KCNN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
RD-KCNN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
RDR-KCNN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Potassium Intermediate Small Conductance Calcium Activated Channel Subfamily N, Member 2 (KCNN2) ELISA Kit |
RDR-KCNN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Mating Factor a-SK2 |
H-4580.0001 |
Bachem |
1.0mg |
EUR 441 |
Description: Sum Formula: C81H106N18O19S; CAS# [89718-47-8] |
Mating Factor a-SK2 |
H-4580.0005 |
Bachem |
5.0mg |
EUR 1675 |
Description: Sum Formula: C81H106N18O19S; CAS# [89718-47-8] |
KCNN2 siRNA |
20-abx902816 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN2 siRNA |
20-abx921298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN2 siRNA |
20-abx921299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNN2 Blocking Peptide |
33R-3914 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN2 antibody, catalog no. 70R-1495 |
KCNN2 Blocking Peptide |
33R-4564 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN2 antibody, catalog no. 70R-5106 |
KCNN2 cloning plasmid |
CSB-CL880957HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 696
- Sequence: atgtggttgatatcaataacttttctctccattggttatggtgacatggtacctaacacatactgtggaaaaggagtctgcttacttactggaattatgggtgctggttgcacagccctggtggtagctgtagtggcaaggaagctagaacttaccaaagcagaaaaacacgtgca
- Show more
|
Description: A cloning plasmid for the KCNN2 gene. |
KCNN2 cloning plasmid |
CSB-CL880957HU2-10ug |
Cusabio |
10ug |
EUR 597 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1740
- Sequence: atgagcagctgcaggtacaacgggggcgtcatgcggccgctcagcaacttgagcgcgtcccgccggaacctgcacgagatggactcagaggcgcagcccctgcagccccccgcgtctgtcggaggaggtggcggcgcgtcctccccgtctgcagccgctgccgccgccgccgctg
- Show more
|
Description: A cloning plasmid for the KCNN2 gene. |
Mouse KCNN2 shRNA Plasmid |
20-abx980248 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat KCNN2 shRNA Plasmid |
20-abx985805 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human KCNN2 shRNA Plasmid |
20-abx952555 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KCNN2 Recombinant Protein (Human) |
RP016660 |
ABM |
100 ug |
Ask for price |
KCNN2 Recombinant Protein (Human) |
RP040261 |
ABM |
100 ug |
Ask for price |
KCNN2 Recombinant Protein (Rat) |
RP206930 |
ABM |
100 ug |
Ask for price |
KCNN2 Recombinant Protein (Mouse) |
RP145304 |
ABM |
100 ug |
Ask for price |
Small Conductance Calcium-Activated Potassium Channel Protein 2 (SK2) Antibody |
abx224215-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
KCNN2 ORF Vector (Human) (pORF) |
ORF005554 |
ABM |
1.0 ug DNA |
EUR 95 |
Kcnn2 ORF Vector (Rat) (pORF) |
ORF068978 |
ABM |
1.0 ug DNA |
EUR 506 |
Kcnn2 ORF Vector (Mouse) (pORF) |
ORF048436 |
ABM |
1.0 ug DNA |
EUR 506 |
KCNN2 ORF Vector (Human) (pORF) |
ORF013421 |
ABM |
1.0 ug DNA |
EUR 354 |
KCNN2 Western Blot kit (AWBK35094) |
AWBK35094 |
Aviva Systems Biology |
10 reactions |
EUR 647 |
Description: - Description of target:
- Species reactivity:
- Application:
- Assay info:
- Sensitivity:
|
KCNN2 ELISA Kit (Human) (OKCD09271) |
OKCD09271 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by KCNN2 is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. KCNN2 is a member of the KCNN family of potassium channel genes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL |
KCNN2 ELISA Kit (Human) (OKDD00355) |
OKDD00355 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.081 ng/mL |
KCNN2 sgRNA CRISPR Lentivector set (Human) |
K1124201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcnn2 sgRNA CRISPR Lentivector set (Mouse) |
K4357101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcnn2 sgRNA CRISPR Lentivector set (Rat) |
K6854501 |
ABM |
3 x 1.0 ug |
EUR 339 |
KCNN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1124202 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1124203 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1124204 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4357102 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4357103 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4357104 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6854502 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6854503 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnn2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6854504 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNN2 Protein Vector (Human) (pPB-C-His) |
PV053681 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPB-N-His) |
PV053682 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPM-C-HA) |
PV053683 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPM-C-His) |
PV053684 |
ABM |
500 ng |
EUR 481 |
KCNN2 Protein Vector (Human) (pPB-C-His) |
PV022213 |
ABM |
500 ng |
EUR 329 |
KCNN2 Protein Vector (Human) (pPB-N-His) |
PV022214 |
ABM |
500 ng |
EUR 329 |
KCNN2 Protein Vector (Human) (pPM-C-HA) |
PV022215 |
ABM |
500 ng |
EUR 329 |
KCNN2 Protein Vector (Human) (pPM-C-His) |
PV022216 |
ABM |
500 ng |
EUR 329 |
KCNN2 Protein Vector (Rat) (pPB-C-His) |
PV275910 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Rat) (pPB-N-His) |
PV275911 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Rat) (pPM-C-HA) |
PV275912 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Rat) (pPM-C-His) |
PV275913 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Mouse) (pPB-C-His) |
PV193742 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Mouse) (pPB-N-His) |
PV193743 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Mouse) (pPM-C-HA) |
PV193744 |
ABM |
500 ng |
EUR 603 |
KCNN2 Protein Vector (Mouse) (pPM-C-His) |
PV193745 |
ABM |
500 ng |
EUR 603 |
Kcnn2 3'UTR Luciferase Stable Cell Line |
TU206610 |
ABM |
1.0 ml |
Ask for price |
Kcnn2 3'UTR GFP Stable Cell Line |
TU160465 |
ABM |
1.0 ml |
Ask for price |
KCNN2 3'UTR Luciferase Stable Cell Line |
TU011535 |
ABM |
1.0 ml |
EUR 1394 |
Kcnn2 3'UTR Luciferase Stable Cell Line |
TU110465 |
ABM |
1.0 ml |
Ask for price |
KCNN2 3'UTR GFP Stable Cell Line |
TU061535 |
ABM |
1.0 ml |
EUR 1394 |
Kcnn2 3'UTR GFP Stable Cell Line |
TU256610 |
ABM |
1.0 ml |
Ask for price |
KCNN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV685939 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV685943 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV685944 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV701817 |
ABM |
1.0 ug DNA |
EUR 450 |
KCNN2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV701821 |
ABM |
1.0 ug DNA |
EUR 450 |
KCNN2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV701822 |
ABM |
1.0 ug DNA |
EUR 450 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |