KCNK4 (TRAAK) Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

KCNK4 (TRAAK) Polyclonal Antibody

ES8324-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNK4 (TRAAK) from Human/Mouse/Rat. This antibody is tested and validated for IHC

KCNK4 (TRAAK) Polyclonal Antibody

ES8324-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNK4 (TRAAK) from Human/Mouse/Rat. This antibody is tested and validated for IHC

Anti-KCNK4 (TRAAK) Antibody

A05944 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KCNK4 (TRAAK) Antibody (KCNK4) detection. Tested with IHC in Human, Rat, Mouse.

Anti-KCNK4 (TRAAK) antibody

STJ97578 200 µl
EUR 197
Description: Rabbit polyclonal to KCNK4 (TRAAK) (A238).

TRAAK Polyclonal Antibody

ABP52633-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TRAAK at AA range: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of TRAAK from Human, Mouse. This TRAAK antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TRAAK at AA range: 310-390

TRAAK Polyclonal Antibody

ABP52633-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TRAAK at AA range: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of TRAAK from Human, Mouse. This TRAAK antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TRAAK at AA range: 310-390

TRAAK Polyclonal Antibody

ABP52633-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TRAAK at AA range: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of TRAAK from Human, Mouse. This TRAAK antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TRAAK at AA range: 310-390

TRAAK Polyclonal Antibody

ES3632-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRAAK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRAAK Polyclonal Antibody

ES3632-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAAK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal K2P4.1 (TRAAK) Antibody

AMM06055G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human K2P4.1 (TRAAK) . This antibody is tested and proven to work in the following applications:

KCNK4 Polyclonal Antibody

27648-100ul 100ul
EUR 252

KCNK4 Polyclonal Antibody

27648-50ul 50ul
EUR 187

KCNK4 Rabbit pAb

A12217-100ul 100 ul
EUR 308

KCNK4 Rabbit pAb

A12217-200ul 200 ul
EUR 459

KCNK4 Rabbit pAb

A12217-20ul 20 ul
EUR 183

KCNK4 Rabbit pAb

A12217-50ul 50 ul
EUR 223

KCNK4 Polyclonal Conjugated Antibody

C27648 100ul
EUR 397

Anti-TRAAK antibody

STJ96079 200 µl
EUR 197
Description: Rabbit polyclonal to TRAAK.

KCNK4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KCNK4. Recognizes KCNK4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

KCNK4 Antibody

DF4309 200ul
EUR 304
Description: KCNK4 Antibody detects endogenous levels of total KCNK4.

KCNK4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against KCNK4. Recognizes KCNK4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200

KCNK4 antibody

70R-7446 50 ug
EUR 467
Description: Rabbit polyclonal KCNK4 antibody raised against the N terminal of KCNK4

KCNK4 antibody

70R-5192 50 ug
EUR 467
Description: Rabbit polyclonal KCNK4 antibody raised against the N terminal of KCNK4

KCNK4 Antibody

ABD4309 100 ug
EUR 438

Anti-KCNK4 antibody

STJ114108 100 µl
EUR 277
Description: This gene encodes a member of the TWIK-related arachidonic acid-stimulated two pore potassium channel subfamily. The encoded protein homodimerizes and functions as an outwardly rectifying channel. This channel is regulated by polyunsaturated fatty acids, temperature and mechanical deformation of the lipid membrane. This protein is expressed primarily in neural tissues and may be involved in regulating the noxious input threshold in dorsal root ganglia neurons. Alternate splicing results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream testis expressed 40 (TEX40) gene, as represented in GeneID: 106780802.

Polyclonal KCNK4 antibody - N-terminal region

AMM06142G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNK4 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal KCNK4 antibody - N-terminal region

AMM06152G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNK4 - N-terminal region. This antibody is tested and proven to work in the following applications:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNK4 Blocking Peptide

33R-2545 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNK4 antibody, catalog no. 70R-7446

KCNK4 Blocking Peptide

33R-6385 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNK4 antibody, catalog no. 70R-5192

KCNK4 Blocking Peptide

DF4309-BP 1mg
EUR 195

KCNK4 cloning plasmid

CSB-CL873692HU-10ug 10ug
EUR 265
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgacgacagctccccaggagccccccgcccggcccctccaggcgggcagtggagctggcccggcgcctgggcgcgccatgcgcagcaccacgctcctggccctgctggcgctggtcttgctttacttggtgtctggtgccctggtgttccgggccctggagcagccccacgagca
  • Show more
Description: A cloning plasmid for the KCNK4 gene.

Human KCNK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse KCNK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KCNK4 Recombinant Protein (Human)

RP016645 100 ug Ask for price

KCNK4 Recombinant Protein (Rat)

RP206900 100 ug Ask for price

KCNK4 Recombinant Protein (Mouse)

RP145208 100 ug Ask for price

Kcnk4 ORF Vector (Rat) (pORF)

ORF068968 1.0 ug DNA
EUR 506

KCNK4 ORF Vector (Human) (pORF)

ORF005549 1.0 ug DNA
EUR 95

Kcnk4 ORF Vector (Mouse) (pORF)

ORF048404 1.0 ug DNA
EUR 506

Kcnk4 sgRNA CRISPR Lentivector set (Rat)

K7016001 3 x 1.0 ug
EUR 339

KCNK4 sgRNA CRISPR Lentivector set (Human)

K1122301 3 x 1.0 ug
EUR 339

Kcnk4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7016002 1.0 ug DNA
EUR 154

Kcnk4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7016003 1.0 ug DNA
EUR 154

Kcnk4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7016004 1.0 ug DNA
EUR 154

KCNK4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1122302 1.0 ug DNA
EUR 154

KCNK4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1122303 1.0 ug DNA
EUR 154

KCNK4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1122304 1.0 ug DNA
EUR 154

KCNK4 Protein Vector (Human) (pPB-C-His)

PV022193 500 ng
EUR 329

KCNK4 Protein Vector (Human) (pPB-N-His)

PV022194 500 ng
EUR 329

KCNK4 Protein Vector (Human) (pPM-C-HA)

PV022195 500 ng
EUR 329

KCNK4 Protein Vector (Human) (pPM-C-His)

PV022196 500 ng
EUR 329

KCNK4 Protein Vector (Rat) (pPB-C-His)

PV275870 500 ng
EUR 603

KCNK4 Protein Vector (Rat) (pPB-N-His)

PV275871 500 ng
EUR 603

KCNK4 Protein Vector (Rat) (pPM-C-HA)

PV275872 500 ng
EUR 603

KCNK4 Protein Vector (Rat) (pPM-C-His)

PV275873 500 ng
EUR 603

KCNK4 Protein Vector (Mouse) (pPB-C-His)

PV193614 500 ng
EUR 603

KCNK4 Protein Vector (Mouse) (pPB-N-His)

PV193615 500 ng
EUR 603

KCNK4 Protein Vector (Mouse) (pPM-C-HA)

PV193616 500 ng
EUR 603

KCNK4 Protein Vector (Mouse) (pPM-C-His)

PV193617 500 ng
EUR 603

Kcnk4 3'UTR Luciferase Stable Cell Line

TU206600 1.0 ml Ask for price

Kcnk4 3'UTR GFP Stable Cell Line

TU256600 1.0 ml Ask for price

KCNK4 3'UTR GFP Stable Cell Line

TU061516 1.0 ml
EUR 1394

KCNK4 3'UTR Luciferase Stable Cell Line

TU011516 1.0 ml
EUR 1394

KCNK4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651469 1.0 ug DNA
EUR 682

KCNK4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651473 1.0 ug DNA
EUR 682

KCNK4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651474 1.0 ug DNA
EUR 682

Potassium Two Pore Domain Channel Subfamily K Member 4 (KCNK4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Potassium Two Pore Domain Channel Subfamily K Member 4 (KCNK4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Potassium Two Pore Domain Channel Subfamily K Member 4 (KCNK4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein