IGFN1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

IGFN1 Polyclonal Antibody

ABP57224-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGFN1 from Human, Mouse, Rat. This IGFN1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

IGFN1 Antibody

1-CSB-PA080195
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

IGFN1 Antibody

1-CSB-PA080268
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat, Pg. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200

Anti-IGFN1 antibody

STJ97418 200 µl
EUR 197
Description: Rabbit polyclonal to IGFN1.

IGFN1 siRNA

20-abx920330
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGFN1 siRNA

20-abx920331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGFN1 cloning plasmid

CSB-CL769786HU-10ug 10ug
EUR 839
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2607
  • Sequence: ATGGGGTGGCAGCCTATGGGAGAGAACTGGGGGTGCCTGGAGGAGATGCTGAATGAAGATCAGAGCCGGGAGCCCCCTGGTCACCTTGGTAGCAGGAGAAGTGGCAAAGACGGCAGGTTGGACATCTATGGAGAGAGGAGAGATGCTACCCGGAGTTCCACATCCAGATACAAGC
  • Show more
Description: A cloning plasmid for the IGFN1 gene.

Mouse IGFN1 shRNA Plasmid

20-abx981490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IGFN1 shRNA Plasmid

20-abx964016
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Igfn1 ELISA KIT

ELI-13407m 96 Tests
EUR 865

Human IGFN1 ELISA KIT

ELI-08308h 96 Tests
EUR 824

IGFN1 ELISA KIT|Human

EF005124 96 Tests
EUR 689

Igfn1 ORF Vector (Mouse) (pORF)

ORF047747 1.0 ug DNA
EUR 3087

IGFN1 ORF Vector (Human) (pORF)

ORF021411 1.0 ug DNA
EUR 405

IGFN1 sgRNA CRISPR Lentivector set (Human)

K1026701 3 x 1.0 ug
EUR 339

Igfn1 sgRNA CRISPR Lentivector set (Mouse)

K4234401 3 x 1.0 ug
EUR 339

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1026702 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1026703 1.0 ug DNA
EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1026704 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4234402 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4234403 1.0 ug DNA
EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4234404 1.0 ug DNA
EUR 154

IGFN1 Protein Vector (Human) (pPB-C-His)

PV085641 500 ng
EUR 811

IGFN1 Protein Vector (Human) (pPB-N-His)

PV085642 500 ng
EUR 811

IGFN1 Protein Vector (Human) (pPM-C-HA)

PV085643 500 ng
EUR 811

IGFN1 Protein Vector (Human) (pPM-C-His)

PV085644 500 ng
EUR 811

IGFN1 Protein Vector (Mouse) (pPB-C-His)

PV190986 500 ng
EUR 4592

IGFN1 Protein Vector (Mouse) (pPB-N-His)

PV190987 500 ng
EUR 4592

IGFN1 Protein Vector (Mouse) (pPM-C-HA)

PV190988 500 ng
EUR 4592

IGFN1 Protein Vector (Mouse) (pPM-C-His)

PV190989 500 ng
EUR 4592

Igfn1 3'UTR GFP Stable Cell Line

TU159974 1.0 ml Ask for price

IGFN1 3'UTR Luciferase Stable Cell Line

TU010544 1.0 ml
EUR 1521

Igfn1 3'UTR Luciferase Stable Cell Line

TU109974 1.0 ml Ask for price

IGFN1 3'UTR GFP Stable Cell Line

TU060544 1.0 ml
EUR 1521

IGFN1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV798693 1.0 ug DNA
EUR 456

IGFN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV798697 1.0 ug DNA
EUR 456

IGFN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV798698 1.0 ug DNA
EUR 456

Immunoglobulin Like And Fibronectin Type III Domain Containing 1 (IGFN1) Antibody

20-abx134088
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody

20-abx326992
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody

20-abx330105
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Igfn1 ELISA Kit| Mouse Immunoglobulin-like and fibronectin type

EF015232 96 Tests
EUR 689

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC