IGFN1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

IGFN1 Polyclonal Antibody
ES8223-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IGFN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IGFN1 Antibody
1-CSB-PA080195	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

IGFN1 Antibody
1-CSB-PA080268	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat, Pg. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200

Anti-IGFN1 antibody
STJ97418	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to IGFN1.

IGFN1 siRNA
20-abx920330	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IGFN1 siRNA
20-abx920331	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IGFN1 cloning plasmid
CSB-CL769786HU-10ug	Cusabio	10ug	EUR 839
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2607 Sequence: ATGGGGTGGCAGCCTATGGGAGAGAACTGGGGGTGCCTGGAGGAGATGCTGAATGAAGATCAGAGCCGGGAGCCCCCTGGTCACCTTGGTAGCAGGAGAAGTGGCAAAGACGGCAGGTTGGACATCTATGGAGAGAGGAGAGATGCTACCCGGAGTTCCACATCCAGATACAAGC Show more
Description: A cloning plasmid for the IGFN1 gene.

Mouse Igfn1 ELISA KIT
ELI-13407m	Lifescience Market	96 Tests	EUR 865

Human IGFN1 ELISA KIT
ELI-08308h	Lifescience Market	96 Tests	EUR 824

IGFN1 ELISA KIT|Human
EF005124	Lifescience Market	96 Tests	EUR 689

Human IGFN1 shRNA Plasmid
20-abx964016	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse IGFN1 shRNA Plasmid
20-abx981490	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IGFN1 ORF Vector (Human) (pORF)
ORF021411	ABM	1.0 ug DNA	EUR 405

Igfn1 ORF Vector (Mouse) (pORF)
ORF047747	ABM	1.0 ug DNA	EUR 3087

Igfn1 sgRNA CRISPR Lentivector set (Mouse)
K4234401	ABM	3 x 1.0 ug	EUR 339

IGFN1 sgRNA CRISPR Lentivector set (Human)
K1026701	ABM	3 x 1.0 ug	EUR 339

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4234402	ABM	1.0 ug DNA	EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4234403	ABM	1.0 ug DNA	EUR 154

Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4234404	ABM	1.0 ug DNA	EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1026702	ABM	1.0 ug DNA	EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1026703	ABM	1.0 ug DNA	EUR 154

IGFN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1026704	ABM	1.0 ug DNA	EUR 154

IGFN1 Protein Vector (Human) (pPB-C-His)
PV085641	ABM	500 ng	EUR 811

IGFN1 Protein Vector (Human) (pPB-N-His)
PV085642	ABM	500 ng	EUR 811

IGFN1 Protein Vector (Human) (pPM-C-HA)
PV085643	ABM	500 ng	EUR 811

IGFN1 Protein Vector (Human) (pPM-C-His)
PV085644	ABM	500 ng	EUR 811

IGFN1 Protein Vector (Mouse) (pPB-C-His)
PV190986	ABM	500 ng	EUR 4592

IGFN1 Protein Vector (Mouse) (pPB-N-His)
PV190987	ABM	500 ng	EUR 4592

IGFN1 Protein Vector (Mouse) (pPM-C-HA)
PV190988	ABM	500 ng	EUR 4592

IGFN1 Protein Vector (Mouse) (pPM-C-His)
PV190989	ABM	500 ng	EUR 4592

Igfn1 3'UTR Luciferase Stable Cell Line
TU109974	ABM	1.0 ml	Ask for price

Igfn1 3'UTR GFP Stable Cell Line
TU159974	ABM	1.0 ml	Ask for price

IGFN1 3'UTR GFP Stable Cell Line
TU060544	ABM	1.0 ml	EUR 1521

IGFN1 3'UTR Luciferase Stable Cell Line
TU010544	ABM	1.0 ml	EUR 1521

IGFN1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV798693	ABM	1.0 ug DNA	EUR 456

IGFN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV798697	ABM	1.0 ug DNA	EUR 456

IGFN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV798698	ABM	1.0 ug DNA	EUR 456

Immunoglobulin Like And Fibronectin Type III Domain Containing 1 (IGFN1) Antibody
20-abx134088	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody
20-abx330105	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody
20-abx326992	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Igfn1 ELISA Kit| Mouse Immunoglobulin-like and fibronectin type
EF015232	Lifescience Market	96 Tests	EUR 689

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187