Order Now: brent@sdlifesciences.com
IGFN1 Polyclonal Antibody |
ABP57224-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IGFN1 from Human, Mouse, Rat. This IGFN1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
IGFN1 Antibody |
1-CSB-PA080195 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500 |
IGFN1 Antibody |
1-CSB-PA080268 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against IGFN1. Recognizes IGFN1 from Human, Mouse, Rat, Pg. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1:2000.IHC:1:50-1:200 |
Anti-IGFN1 antibody |
STJ97418 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to IGFN1. |
IGFN1 siRNA |
20-abx920330 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IGFN1 siRNA |
20-abx920331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IGFN1 cloning plasmid |
CSB-CL769786HU-10ug |
Cusabio |
10ug |
EUR 839 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2607
- Sequence: ATGGGGTGGCAGCCTATGGGAGAGAACTGGGGGTGCCTGGAGGAGATGCTGAATGAAGATCAGAGCCGGGAGCCCCCTGGTCACCTTGGTAGCAGGAGAAGTGGCAAAGACGGCAGGTTGGACATCTATGGAGAGAGGAGAGATGCTACCCGGAGTTCCACATCCAGATACAAGC
- Show more
|
Description: A cloning plasmid for the IGFN1 gene. |
Mouse IGFN1 shRNA Plasmid |
20-abx981490 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human IGFN1 shRNA Plasmid |
20-abx964016 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Igfn1 ORF Vector (Mouse) (pORF) |
ORF047747 |
ABM |
1.0 ug DNA |
EUR 3087 |
IGFN1 ORF Vector (Human) (pORF) |
ORF021411 |
ABM |
1.0 ug DNA |
EUR 405 |
IGFN1 sgRNA CRISPR Lentivector set (Human) |
K1026701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Igfn1 sgRNA CRISPR Lentivector set (Mouse) |
K4234401 |
ABM |
3 x 1.0 ug |
EUR 339 |
IGFN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1026702 |
ABM |
1.0 ug DNA |
EUR 154 |
IGFN1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1026703 |
ABM |
1.0 ug DNA |
EUR 154 |
IGFN1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1026704 |
ABM |
1.0 ug DNA |
EUR 154 |
Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4234402 |
ABM |
1.0 ug DNA |
EUR 154 |
Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4234403 |
ABM |
1.0 ug DNA |
EUR 154 |
Igfn1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4234404 |
ABM |
1.0 ug DNA |
EUR 154 |
IGFN1 Protein Vector (Human) (pPB-C-His) |
PV085641 |
ABM |
500 ng |
EUR 811 |
IGFN1 Protein Vector (Human) (pPB-N-His) |
PV085642 |
ABM |
500 ng |
EUR 811 |
IGFN1 Protein Vector (Human) (pPM-C-HA) |
PV085643 |
ABM |
500 ng |
EUR 811 |
IGFN1 Protein Vector (Human) (pPM-C-His) |
PV085644 |
ABM |
500 ng |
EUR 811 |
IGFN1 Protein Vector (Mouse) (pPB-C-His) |
PV190986 |
ABM |
500 ng |
EUR 4592 |
IGFN1 Protein Vector (Mouse) (pPB-N-His) |
PV190987 |
ABM |
500 ng |
EUR 4592 |
IGFN1 Protein Vector (Mouse) (pPM-C-HA) |
PV190988 |
ABM |
500 ng |
EUR 4592 |
IGFN1 Protein Vector (Mouse) (pPM-C-His) |
PV190989 |
ABM |
500 ng |
EUR 4592 |
Igfn1 3'UTR GFP Stable Cell Line |
TU159974 |
ABM |
1.0 ml |
Ask for price |
IGFN1 3'UTR Luciferase Stable Cell Line |
TU010544 |
ABM |
1.0 ml |
EUR 1521 |
Igfn1 3'UTR Luciferase Stable Cell Line |
TU109974 |
ABM |
1.0 ml |
Ask for price |
IGFN1 3'UTR GFP Stable Cell Line |
TU060544 |
ABM |
1.0 ml |
EUR 1521 |
IGFN1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV798693 |
ABM |
1.0 ug DNA |
EUR 456 |
IGFN1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV798697 |
ABM |
1.0 ug DNA |
EUR 456 |
IGFN1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV798698 |
ABM |
1.0 ug DNA |
EUR 456 |
Immunoglobulin Like And Fibronectin Type III Domain Containing 1 (IGFN1) Antibody |
20-abx134088 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody |
20-abx326992 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Immunoglobulin Like and Fibronectin Type III Domain Containing 1 (IGFN1) Antibody |
20-abx330105 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Igfn1 ELISA Kit| Mouse Immunoglobulin-like and fibronectin type |
EF015232 |
Lifescience Market |
96 Tests |
EUR 689 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |