Order Now: brent@sdlifesciences.com
HAO1 Polyclonal Antibody |
ABP57253-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
HAO1 Polyclonal Antibody |
ABP57253-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A polyclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
HAO1 Polyclonal Antibody |
ES8252-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HAO1 from Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HAO1 Polyclonal Antibody |
ES8252-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HAO1 from Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HAO1 Rabbit pAb |
A6470-100ul |
Abclonal |
100 ul |
EUR 308 |
HAO1 Rabbit pAb |
A6470-200ul |
Abclonal |
200 ul |
EUR 459 |
HAO1 Rabbit pAb |
A6470-20ul |
Abclonal |
20 ul |
EUR 183 |
HAO1 Rabbit pAb |
A6470-50ul |
Abclonal |
50 ul |
EUR 223 |
HAO1/GOX Polyclonal Antibody |
EA223-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
HAO1/GOX Polyclonal Antibody |
EA223-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
Polyclonal HAO1 Antibody (Center) |
AMM05297G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAO1 (Center). This antibody is tested and proven to work in the following applications: |
HAO1 antibody |
70R-3102 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal HAO1 antibody |
HAO1 antibody |
38946-100ul |
SAB |
100ul |
EUR 252 |
HAO1 antibody |
10R-4292 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal HAO1 antibody |
HAO1 antibody |
10R-4293 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal HAO1 antibody |
HAO1 antibody |
10R-4294 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal HAO1 antibody |
HAO1 Antibody |
43063-100ul |
SAB |
100ul |
EUR 252 |
HAO1 Antibody |
1-CSB-PA080232 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000 |
HAO1 Antibody |
1-CSB-PA891938LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
HAO1 Polyclonal Antibody, HRP Conjugated |
A69312 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
HAO1 Polyclonal Antibody, FITC Conjugated |
A69313 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
HAO1 Polyclonal Antibody, Biotin Conjugated |
A69314 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
HAO1 Monoclonal Antibody |
40484-100ul |
SAB |
100ul |
EUR 252 |
HAO1 Monoclonal Antibody |
40484-50ul |
SAB |
50ul |
EUR 187 |
HAO1 Conjugated Antibody |
C43063 |
SAB |
100ul |
EUR 397 |
HAO1 Conjugated Antibody |
C38946 |
SAB |
100ul |
EUR 397 |
HAO1 Monoclonal Antibody |
ABM40189-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
HAO1 Monoclonal Antibody |
ABM40189-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
HAO1 Monoclonal Antibody |
ABM40189-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of HAO1 from Mouse, Rat. This HAO1 antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein |
anti- HAO1 antibody |
FNab03752 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: hydroxyacid oxidase (glycolate oxidase) 1
- Uniprot ID: Q9UJM8
- Gene ID: 54363
- Research Area: Metabolism
|
Description: Antibody raised against HAO1 |
Anti-HAO1 antibody |
STJ28553 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. |
Anti-HAO1 antibody |
STJ97395 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: HAO1 is a protein encoded by the HAO1 gene which is approximately 40,9 kDa. HAO1 is localised to the peroxisome. It is involved in carbon metabolism, glyoxylate metabolism and glycine degradation. It has 2-hydroxy-acid oxidase activity and is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 is expressed in the liver. Mutations in the HAO1 gene may result in primary hyperoxaluria. STJ97395 was developed from clone Mix and was affinity-purified from mouse ascites by affinity-chromatography using epitope-specific immunogen. The antibody detects endogenous HAO1 protein. |
Anti-HAO1 antibody |
STJ97454 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to HAO1. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat) |
4-PAG364Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1) |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat) |
4-PAG364Ra02 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1) |
HAO1 siRNA |
20-abx919067 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAO1 siRNA |
20-abx919068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-HAO1 |
YF-PA19286 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to HAO1 |
anti-HAO1 |
YF-PA19287 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to HAO1 |
anti-HAO1 |
YF-PA27564 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to HAO1 |
HAO1 Antibody, HRP conjugated |
1-CSB-PA891938LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HAO1 Antibody, FITC conjugated |
1-CSB-PA891938LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HAO1 Antibody, Biotin conjugated |
1-CSB-PA891938LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HAO1. Recognizes HAO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
HAO1/GOX Monoclonal Antibody |
EM1180-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Mouse Monoclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA |
HAO1/GOX Monoclonal Antibody |
EM1180-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Mouse Monoclonal antibody against HAO1/GOX from Rat/ Mouse. This antibody is tested and validated for WB, ELISA |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat) |
4-PAG364Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1) |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC |
4-PAG364Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Biotinylated |
4-PAG364Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Biotin. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Cy3 |
4-PAG364Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Cy3. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), FITC |
4-PAG364Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with FITC. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), HRP |
4-PAG364Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with HRP. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), PE |
4-PAG364Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with PE. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC |
4-PAG364Ra02-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Biotinylated |
4-PAG364Ra02-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Biotin. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), Cy3 |
4-PAG364Ra02-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Cy3. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), FITC |
4-PAG364Ra02-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with FITC. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), HRP |
4-PAG364Ra02-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with HRP. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), PE |
4-PAG364Ra02-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with PE. |
HAO1 Blocking Peptide |
33R-3411 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAO1 antibody, catalog no. 70R-3102 |
HAO1 cloning plasmid |
CSB-CL891938HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1113
- Sequence: atgctcccccggctaatttgtatcaatgattatgaacaacatgctaaatcagtacttccaaagtctatatatgactattacaggtctggggcaaatgatgaagaaactttggctgataatattgcagcattttccagatggaagctgtatccaaggatgctccggaatgttgctg
- Show more
|
Description: A cloning plasmid for the HAO1 gene. |
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx004961 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx102158 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx102159 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx102160 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx134170 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx134171 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx159526 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx141512 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
abx034021-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
abx034021-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
abx233752-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx330226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody |
20-abx334179 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), APC |
4-PAG364Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAG364Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Biotin. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAG364Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with Cy3. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAG364Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with FITC. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAG364Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with HRP. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), PE |
4-PAG364Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with PE. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAG364Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC-Cy7. |
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAG364Ra02-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Gly102~Lys357)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC-Cy7. |
Anti-HAO1/Hydroxyacid Oxidase 1 Antibody |
A09159 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for HAO1 Antibody (HAO1) detection.tested for WB in Mouse, Rat. |
Hydroxyacid Oxidase 1 (HAO1) Antibody (HRP) |
20-abx336075 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody (FITC) |
20-abx336076 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Antibody (Biotin) |
20-abx336077 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Hydroxyacid Oxidase 1 (HAO1) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAG364Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HAO1 (Ser113~Lys369)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Hydroxyacid Oxidase 1 (HAO1). This antibody is labeled with APC-Cy7. |
HAO1 protein (His tag) |
80R-1929 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant HAO1 protein |