HAND1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

HAND1 Polyclonal Antibody

ABP57041-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190

HAND1 Polyclonal Antibody

ABP57041-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190

HAND1 Polyclonal Antibody

ABP57042-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98

HAND1 Polyclonal Antibody

ABP57042-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98

HAND1 Polyclonal Antibody

ABP57042-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98

HAND1 Rabbit pAb

A9855-100ul 100 ul
EUR 308

HAND1 Rabbit pAb

A9855-200ul 200 ul
EUR 459

HAND1 Rabbit pAb

A9855-20ul 20 ul
EUR 183

HAND1 Rabbit pAb

A9855-50ul 50 ul
EUR 223

Polyclonal HAND1 Antibody (Center)

AMM08774G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HAND1 Antibody (Center)

APR03959G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (Center). This antibody is tested and proven to work in the following applications:

HAND1 Antibody

BF0261 200ul
EUR 376
Description: HAND1 antibody detects endogenous levels of total HAND1.

HAND1 Antibody

AF0673 200ul
EUR 304
Description: HAND1 Antibody detects endogenous levels of HAND1.

HAND1 Antibody

ABF0673 100 ug
EUR 438

HAND1 antibody

70R-36538 100 ug
EUR 327
Description: Rabbit polyclonal HAND1 antibody

HAND1 antibody

70R-31550 100 ug
EUR 327
Description: Rabbit polyclonal HAND1 antibody

HAND1 Antibody

33643-100ul 100ul
EUR 252

HAND1 Antibody

33643-50ul 50ul
EUR 187

HAND1 Antibody

43771-100ul 100ul
EUR 252

HAND1 Antibody

43962-100ul 100ul
EUR 252

HAND1 antibody

10R-1997 100 ul
EUR 403
Description: Mouse monoclonal HAND1 antibody

HAND1 antibody

10R-4290 100 ul
EUR 726
Description: Mouse monoclonal HAND1 antibody

HAND1 Antibody

1-CSB-PA010125ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HAND1 Antibody

CSB-PA182098-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

HAND1 Antibody

CSB-PA182098-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

HAND1 Antibody

1-CSB-PA080003
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/10000

HAND1 Antibody

1-CSB-PA080004
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

Polyclonal HAND1 Antibody (aa183-196)

APR02313G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (aa183-196). This antibody is tested and proven to work in the following applications:

Polyclonal HAND1 Antibody (N-term)

AMM08775G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (N-term). This antibody is tested and proven to work in the following applications:

HAND1 (phospho Ser98) Polyclonal Antibody

ES8039-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HAND1 (phospho Ser98) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

HAND1 (phospho Ser98) Polyclonal Antibody

ES8039-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HAND1 (phospho Ser98) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

HAND1 (phospho Ser98) Polyclonal Antibody

ABP57040-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human HAND1 around the phosphorylation site of S98
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 phospho Ser98) from Human, Mouse, Rat. This HAND1 phospho Ser98) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the phosphorylation site of S98

HAND1 (phospho Ser98) Polyclonal Antibody

ABP57040-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human HAND1 around the phosphorylation site of S98
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 phospho Ser98) from Human, Mouse, Rat. This HAND1 phospho Ser98) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the phosphorylation site of S98

HAND1 (phospho Ser98) Polyclonal Antibody

ABP57040-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human HAND1 around the phosphorylation site of S98
  • Applications tips:
Description: A polyclonal antibody for detection of HAND1 phospho Ser98) from Human, Mouse, Rat. This HAND1 phospho Ser98) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the phosphorylation site of S98

HAND1 (Phospho-Ser98) Polyclonal Conjugated Antibody

C12440 100ul
EUR 397

HAND1 Conjugated Antibody

C43771 100ul
EUR 397

HAND1 Conjugated Antibody

C43962 100ul
EUR 397

HAND1 (pS98) Antibody

abx215814-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-HAND1 Antibody

A06496 100ul
EUR 397
Description: Rabbit Polyclonal HAND1 Antibody. Validated in IF and tested in Human.

Anti-HAND1 Antibody

A06496-1 100ul
EUR 397
Description: Rabbit Polyclonal HAND1 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human HAND1 Antibody

32730-05111 150 ug
EUR 261

Anti-HAND1 antibody

STJ92865 200 µl
EUR 197
Description: Rabbit polyclonal to HAND1.

Anti-HAND1 antibody

STJ92866 200 µl
EUR 197
Description: Rabbit polyclonal to HAND1.

Anti-HAND1 antibody

STJ98125 100 µl
EUR 234
Description: Mouse monoclonal to HAND1.

Anti-HAND1 antibody

STJ111897 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation.

Hand1/ Rat Hand1 ELISA Kit

ELI-08006r 96 Tests
EUR 886

HAND1 siRNA

20-abx902407
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAND1 siRNA

20-abx919063
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAND1 siRNA

20-abx919064
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-HAND1 (Ser98) Antibody

AF8063 200ul
EUR 376
Description: HAND1 (Phospho-Ser98) Antibody detects endogenous levels of HAND1 only when phosphorylated at Ser98.

HAND1 (Phospho- Ser98) Antibody

ABF8063 100 ug
EUR 438

HAND1 (Phospho-Ser98) Antibody

12440-100ul 100ul
EUR 252

HAND1 (Phospho-Ser98) Antibody

12440-50ul 50ul
EUR 187

Phospho-HAND1 (S98) Antibody

1-CSB-PA080002
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-HAND1 (S98). Recognizes Phospho-HAND1 (S98) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

HAND1 Blocking Peptide

BF0261-BP 1mg
EUR 195

HAND1 Blocking Peptide

AF0673-BP 1mg
EUR 195

HAND1 cloning plasmid

CSB-CL010125HU-10ug 10ug
EUR 292
  • Formulation: 10 ĂŽÂĽg plasmid + 200ĂŽÂĽl Glycerol
  • Length: 648
  • Sequence: atgaacctcgtgggcagctacgcacaccatcaccaccatcaccacccgcaccctgcgcaccccatgctccacgaacccttcctcttcggtccggcctcgcgctgtcatcaggaaaggccctacttccagagctggctgctgagcccggctgacgctgccccggacttccctgcggg
  • Show more
Description: A cloning plasmid for the HAND1 gene.

HAND1 Blocking Peptide

20-abx162479
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

anti-HAND1 (8E7A11)

LF-MA30206 100 ul
EUR 486
Description: Mouse Monoclonal to HAND1

Human HAND1 Antibody (Biotin Conjugate)

32730-05121 150 ug
EUR 369