Order Now: brent@sdlifesciences.com
HAND1 Polyclonal Antibody |
ABP57041-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190 |
HAND1 Polyclonal Antibody |
ABP57041-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human HAND1 at AA range: 110-190 |
HAND1 Polyclonal Antibody |
ABP57042-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98 |
HAND1 Polyclonal Antibody |
ABP57042-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98 |
HAND1 Polyclonal Antibody |
ABP57042-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 from Human, Mouse, Rat. This HAND1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the non-phosphorylation site of S98 |
HAND1 Rabbit pAb |
A9855-100ul |
Abclonal |
100 ul |
EUR 308 |
HAND1 Rabbit pAb |
A9855-200ul |
Abclonal |
200 ul |
EUR 459 |
HAND1 Rabbit pAb |
A9855-20ul |
Abclonal |
20 ul |
EUR 183 |
HAND1 Rabbit pAb |
A9855-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal HAND1 Antibody (Center) |
AMM08774G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal HAND1 Antibody (Center) |
APR03959G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (Center). This antibody is tested and proven to work in the following applications: |
HAND1 Antibody |
BF0261 |
Affbiotech |
200ul |
EUR 376 |
Description: HAND1 antibody detects endogenous levels of total HAND1. |
HAND1 Antibody |
AF0673 |
Affbiotech |
200ul |
EUR 304 |
Description: HAND1 Antibody detects endogenous levels of HAND1. |
HAND1 antibody |
70R-36538 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HAND1 antibody |
HAND1 antibody |
70R-31550 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal HAND1 antibody |
HAND1 Antibody |
33643-100ul |
SAB |
100ul |
EUR 252 |
HAND1 Antibody |
33643-50ul |
SAB |
50ul |
EUR 187 |
HAND1 Antibody |
43771-100ul |
SAB |
100ul |
EUR 252 |
HAND1 Antibody |
43962-100ul |
SAB |
100ul |
EUR 252 |
HAND1 antibody |
10R-1997 |
Fitzgerald |
100 ul |
EUR 403 |
Description: Mouse monoclonal HAND1 antibody |
HAND1 antibody |
10R-4290 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal HAND1 antibody |
HAND1 Antibody |
1-CSB-PA010125ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
HAND1 Antibody |
CSB-PA182098- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500 |
HAND1 Antibody |
CSB-PA182098-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500 |
HAND1 Antibody |
1-CSB-PA080003 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/10000 |
HAND1 Antibody |
1-CSB-PA080004 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against HAND1. Recognizes HAND1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000 |
Polyclonal HAND1 Antibody (aa183-196) |
APR02313G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (aa183-196). This antibody is tested and proven to work in the following applications: |
Polyclonal HAND1 Antibody (N-term) |
AMM08775G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAND1 (N-term). This antibody is tested and proven to work in the following applications: |
HAND1 (phospho Ser98) Polyclonal Antibody |
ES8039-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HAND1 (phospho Ser98) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
HAND1 (phospho Ser98) Polyclonal Antibody |
ES8039-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HAND1 (phospho Ser98) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
HAND1 (phospho Ser98) Polyclonal Antibody |
ABP57040-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human HAND1 around the phosphorylation site of S98
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 phospho Ser98) from Human, Mouse, Rat. This HAND1 phospho Ser98) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the phosphorylation site of S98 |
HAND1 (phospho Ser98) Polyclonal Antibody |
ABP57040-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human HAND1 around the phosphorylation site of S98
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 phospho Ser98) from Human, Mouse, Rat. This HAND1 phospho Ser98) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the phosphorylation site of S98 |
HAND1 (phospho Ser98) Polyclonal Antibody |
ABP57040-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human HAND1 around the phosphorylation site of S98
- Applications tips:
|
Description: A polyclonal antibody for detection of HAND1 phospho Ser98) from Human, Mouse, Rat. This HAND1 phospho Ser98) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human HAND1 around the phosphorylation site of S98 |
HAND1 (Phospho-Ser98) Polyclonal Conjugated Antibody |
C12440 |
SAB |
100ul |
EUR 397 |
HAND1 Conjugated Antibody |
C43771 |
SAB |
100ul |
EUR 397 |
HAND1 Conjugated Antibody |
C43962 |
SAB |
100ul |
EUR 397 |
HAND1 (pS98) Antibody |
abx215814-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-HAND1 Antibody |
A06496 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal HAND1 Antibody. Validated in IF and tested in Human. |
Anti-HAND1 Antibody |
A06496-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal HAND1 Antibody. Validated in IHC and tested in Human, Mouse, Rat. |
Human HAND1 Antibody |
32730-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-HAND1 antibody |
STJ92865 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to HAND1. |
Anti-HAND1 antibody |
STJ92866 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to HAND1. |
Anti-HAND1 antibody |
STJ98125 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to HAND1. |
Anti-HAND1 antibody |
STJ111897 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation. |
HAND1 siRNA |
20-abx902407 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND1 siRNA |
20-abx919063 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND1 siRNA |
20-abx919064 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-HAND1 (Ser98) Antibody |
AF8063 |
Affbiotech |
200ul |
EUR 376 |
Description: HAND1 (Phospho-Ser98) Antibody detects endogenous levels of HAND1 only when phosphorylated at Ser98. |
HAND1 (Phospho-Ser98) Antibody |
12440-100ul |
SAB |
100ul |
EUR 252 |
HAND1 (Phospho-Ser98) Antibody |
12440-50ul |
SAB |
50ul |
EUR 187 |
Phospho-HAND1 (S98) Antibody |
1-CSB-PA080002 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-HAND1 (S98). Recognizes Phospho-HAND1 (S98) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000 |
HAND1 Blocking Peptide |
BF0261-BP |
Affbiotech |
1mg |
EUR 195 |
HAND1 Blocking Peptide |
AF0673-BP |
Affbiotech |
1mg |
EUR 195 |
HAND1 cloning plasmid |
CSB-CL010125HU-10ug |
Cusabio |
10ug |
EUR 292 |
- Formulation: 10 ĂŽÂĽg plasmid + 200ĂŽÂĽl Glycerol
- Length: 648
- Sequence: atgaacctcgtgggcagctacgcacaccatcaccaccatcaccacccgcaccctgcgcaccccatgctccacgaacccttcctcttcggtccggcctcgcgctgtcatcaggaaaggccctacttccagagctggctgctgagcccggctgacgctgccccggacttccctgcggg
- Show more
|
Description: A cloning plasmid for the HAND1 gene. |
HAND1 Blocking Peptide |
20-abx162479 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-HAND1 (8E7A11) |
LF-MA30206 |
Abfrontier |
100 ul |
EUR 486 |
Description: Mouse Monoclonal to HAND1 |
Human HAND1 Antibody (Biotin Conjugate) |
32730-05121 |
AssayPro |
150 ug |
EUR 369 |