Order Now: brent@sdlifesciences.com
GRIK2(GluR6) Polyclonal Antibody |
EA297-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GRIK2(GluR6) from Human. This antibody is tested and validated for IHC |
GRIK2 (GluR6) Polyclonal Antibody |
ES8326-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GRIK2 (GluR6) from Human. This antibody is tested and validated for IHC |
GRIK2 (GluR6) Polyclonal Antibody |
ES8326-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GRIK2 (GluR6) from Human. This antibody is tested and validated for IHC |
GRIK2 (GluR6) Polyclonal Antibody |
ABP57333-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of GRIK2 GluR6) from Human. This GRIK2 GluR6) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
GRIK2 (GluR6) Polyclonal Antibody |
ABP57333-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of GRIK2 GluR6) from Human. This GRIK2 GluR6) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
GRIK2 (GluR6) Polyclonal Antibody |
ABP57333-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of GRIK2 GluR6) from Human. This GRIK2 GluR6) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
Anti-GRIK2 (GluR6) Antibody |
A03374 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for GRIK2 (GluR6) Antibody (GRIK2) detection. Tested with IHC in Human. |
Anti-GRIK2 (GluR6) antibody |
STJ97580 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to GRIK2 (GluR6) (A240). |
GluR6 Antibody |
AF5460 |
Affbiotech |
200ul |
EUR 304 |
Description: GluR6 Antibody detects endogenous levels of total GluR6. |
GluR6 antibody |
70R-31210 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal GluR6 antibody |
GluR6 Antibody |
33389-100ul |
SAB |
100ul |
EUR 252 |
GluR6 Antibody |
33389-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal Grik2 Antibody |
APC00057G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Grik2 . This antibody is tested and proven to work in the following applications: |
GluR6 Conjugated Antibody |
C33389 |
SAB |
100ul |
EUR 397 |
Anti-GluR6 Antibody |
A06163 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal GluR6 Antibody. Validated in IHC, WB and tested in Mouse. |
GRIK2 Rabbit pAb |
A1939-100ul |
Abclonal |
100 ul |
EUR 308 |
GRIK2 Rabbit pAb |
A1939-200ul |
Abclonal |
200 ul |
EUR 459 |
GRIK2 Rabbit pAb |
A1939-20ul |
Abclonal |
20 ul |
EUR 183 |
GRIK2 Rabbit pAb |
A1939-50ul |
Abclonal |
50 ul |
EUR 223 |
GRIK2 antibody |
70R-5200 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GRIK2 antibody raised against the C terminal of GRIK2 |
GRIK2 Antibody |
32509-100ul |
SAB |
100ul |
EUR 252 |
Grik2 Antibody |
24602-100ul |
SAB |
100ul |
EUR 390 |
GRIK2 antibody |
70R-17601 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GRIK2 antibody |
GRIK2 antibody |
70R-1522 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal GRIK2 antibody raised against the N terminal of GRIK2 |
GRIK2 antibody |
70R-1530 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal GRIK2 antibody raised against the N terminal of GRIK2 |
GRIK2 Antibody |
DF6706 |
Affbiotech |
200ul |
EUR 304 |
Description: GRIK2 Antibody detects endogenous levels of total GRIK2. |
GRIK2 Antibody |
1-CSB-PA618751LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GRIK2 Antibody |
1-CSB-PA413776 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200 |
GRIK2 Antibody |
1-CSB-PA009907GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Rabbit GRIK2 ELISA Kit |
ERTG0263 |
Abclonal |
96Tests |
EUR 521 |
GluR6 Blocking Peptide |
AF5460-BP |
Affbiotech |
1mg |
EUR 195 |
Glutamate Receptor 6 (GLUR6) Antibody |
20-abx141648 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
GRIK2 Conjugated Antibody |
C32509 |
SAB |
100ul |
EUR 397 |
anti- GRIK2 antibody |
FNab03648 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: glutamate receptor, ionotropic, kainate 2
- Uniprot ID: Q13002
- Gene ID: 2898
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against GRIK2 |
Anti-GRIK2 antibody |
STJ23862 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. Mutations in this gene have been associated with autosomal recessive mental retardation. |
GRIK2 siRNA |
20-abx902315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GRIK2 siRNA |
20-abx918686 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GRIK2 siRNA |
20-abx918687 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GRIK2 |
YF-PA12125 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to GRIK2 |
GRIK2 Antibody, HRP conjugated |
1-CSB-PA618751LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GRIK2 Antibody, FITC conjugated |
1-CSB-PA618751LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GRIK2 Antibody, Biotin conjugated |
1-CSB-PA618751LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GRIK2 cloning plasmid |
CSB-CL618751HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1062
- Sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagat
- Show more
|
Description: A cloning plasmid for the GRIK2 gene. |
GRIK2 cloning plasmid |
CSB-CL618751HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1752
- Sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagat
- Show more
|
Description: A cloning plasmid for the GRIK2 gene. |
GRIK2 Blocking Peptide |
33R-5447 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIK2 antibody, catalog no. 70R-1530 |
GRIK2 Blocking Peptide |
33R-7009 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIK2 antibody, catalog no. 70R-1522 |
GRIK2 Blocking Peptide |
33R-8980 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIK2 antibody, catalog no. 70R-5200 |
GRIK2 Blocking Peptide |
DF6706-BP |
Affbiotech |
1mg |
EUR 195 |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human) |
4-PAC018Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), APC |
4-PAC018Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with APC. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), Biotinylated |
4-PAC018Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with Biotin. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), Cy3 |
4-PAC018Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with Cy3. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), FITC |
4-PAC018Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with FITC. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), HRP |
4-PAC018Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with HRP. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), PE |
4-PAC018Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with PE. |
Rat GRIK2 shRNA Plasmid |
20-abx985800 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GRIK2 ELISA Kit |
EHG0263 |
Abclonal |
96Tests |
EUR 521 |
Goat GRIK2 ELISA Kit |
EGTG0263 |
Abclonal |
96Tests |
EUR 521 |
Canine GRIK2 ELISA Kit |
ECG0263 |
Abclonal |
96Tests |
EUR 521 |
Bovine GRIK2 ELISA Kit |
EBG0263 |
Abclonal |
96Tests |
EUR 521 |
Anserini GRIK2 ELISA Kit |
EAG0263 |
Abclonal |
96Tests |
EUR 521 |
Porcine GRIK2 ELISA Kit |
EPG0263 |
Abclonal |
96Tests |
EUR 521 |
Rat GRIK2 ELISA Kit |
ERG0263 |
Abclonal |
96Tests |
EUR 521 |
Mouse GRIK2 ELISA Kit |
EMG0263 |
Abclonal |
96Tests |
EUR 521 |
Mouse GRIK2 shRNA Plasmid |
20-abx970663 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GRIK2 shRNA Plasmid |
20-abx951952 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rabbit Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) ELISA Kit |
abx363088-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) ELISA kit |
E04G0397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) ELISA kit |
E04G0397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) ELISA kit |
E04G0397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC018Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRIK2 (Asn286~Pro561)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with APC-Cy7. |
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
20-abx112746 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
20-abx130982 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
20-abx001584 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
abx028048-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
abx028048-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
20-abx323185 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
abx340079-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody |
abx233648-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Guinea Pig GRIK2 ELISA Kit |
EGG0263 |
Abclonal |
96Tests |
EUR 521 |
GRIK2 ORF Vector (Human) (pORF) |
ORF004677 |
ABM |
1.0 ug DNA |
EUR 95 |
GRIK2 ORF Vector (Human) (pORF) |
ORF004678 |
ABM |
1.0 ug DNA |
EUR 95 |
Grik2 ORF Vector (Rat) (pORF) |
ORF067884 |
ABM |
1.0 ug DNA |
EUR 506 |
Grik2 ORF Vector (Mouse) (pORF) |
ORF046664 |
ABM |
1.0 ug DNA |
EUR 506 |
Grik2 ORF Vector (Mouse) (pORF) |
ORF046665 |
ABM |
1.0 ug DNA |
EUR 506 |
GRIK2 ELISA Kit (Human) (OKEI00232) |
OKEI00232 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Ionotropic glutamate receptor. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist . May be involved in the transmission of light information from the retina to the hypothalamus. Modulates cell surface expression of NETO2.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
GRIK2 ELISA Kit (Rat) (OKEI00777) |
OKEI00777 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Ionotropic glutamate receptor. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist . May be involved in the transmission of light information from the retina to the hypothalamus. Modulates cell surface expression of NETO2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL |
GRIK2 sgRNA CRISPR Lentivector set (Human) |
K0906301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Grik2 sgRNA CRISPR Lentivector set (Mouse) |
K4502301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Grik2 sgRNA CRISPR Lentivector set (Rat) |
K6788901 |
ABM |
3 x 1.0 ug |
EUR 339 |
GRIK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0906302 |
ABM |
1.0 ug DNA |
EUR 154 |
GRIK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0906303 |
ABM |
1.0 ug DNA |
EUR 154 |
GRIK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0906304 |
ABM |
1.0 ug DNA |
EUR 154 |
Grik2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4502302 |
ABM |
1.0 ug DNA |
EUR 154 |
Grik2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4502303 |
ABM |
1.0 ug DNA |
EUR 154 |
Grik2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4502304 |
ABM |
1.0 ug DNA |
EUR 154 |
Grik2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6788902 |
ABM |
1.0 ug DNA |
EUR 154 |
Grik2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6788903 |
ABM |
1.0 ug DNA |
EUR 154 |
Grik2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6788904 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) |
4-RPC018Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q13002
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Glutamate Receptor, Ionotropic, Kainate 2 expressed in: E.coli |
GRIK2 Protein Vector (Rat) (pPB-C-His) |
PV271534 |
ABM |
500 ng |
EUR 1166 |
GRIK2 Protein Vector (Rat) (pPB-N-His) |
PV271535 |
ABM |
500 ng |
EUR 1166 |
GRIK2 Protein Vector (Rat) (pPM-C-HA) |
PV271536 |
ABM |
500 ng |
EUR 1166 |
GRIK2 Protein Vector (Rat) (pPM-C-His) |
PV271537 |
ABM |
500 ng |
EUR 1166 |
GRIK2 Protein Vector (Human) (pPB-C-His) |
PV018705 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPB-N-His) |
PV018706 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPM-C-HA) |
PV018707 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPM-C-His) |
PV018708 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPB-C-His) |
PV018709 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPB-N-His) |
PV018710 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPM-C-HA) |
PV018711 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Human) (pPM-C-His) |
PV018712 |
ABM |
500 ng |
EUR 329 |
GRIK2 Protein Vector (Mouse) (pPB-C-His) |
PV186654 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPB-N-His) |
PV186655 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPM-C-HA) |
PV186656 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPM-C-His) |
PV186657 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPB-C-His) |
PV186658 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPB-N-His) |
PV186659 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPM-C-HA) |
PV186660 |
ABM |
500 ng |
EUR 1065 |
GRIK2 Protein Vector (Mouse) (pPM-C-His) |
PV186661 |
ABM |
500 ng |
EUR 1065 |
Grik2 3'UTR Luciferase Stable Cell Line |
TU205452 |
ABM |
1.0 ml |
Ask for price |
Grik2 3'UTR GFP Stable Cell Line |
TU159108 |
ABM |
1.0 ml |
Ask for price |
GRIK2 3'UTR Luciferase Stable Cell Line |
TU009315 |
ABM |
1.0 ml |
EUR 1521 |
Grik2 3'UTR Luciferase Stable Cell Line |
TU109108 |
ABM |
1.0 ml |
Ask for price |
GRIK2 3'UTR GFP Stable Cell Line |
TU059315 |
ABM |
1.0 ml |
EUR 1521 |
Grik2 3'UTR GFP Stable Cell Line |
TU255452 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |