GRIK2 (GluR6) Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

GRIK2(GluR6) Polyclonal Antibody
EA297-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GRIK2(GluR6) from Human. This antibody is tested and validated for IHC
GRIK2 (GluR6) Polyclonal Antibody
ES8326-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GRIK2 (GluR6) from Human. This antibody is tested and validated for IHC
GRIK2 (GluR6) Polyclonal Antibody
ES8326-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GRIK2 (GluR6) from Human. This antibody is tested and validated for IHC
GRIK2 (GluR6) Polyclonal Antibody
ABP57333-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of GRIK2 GluR6) from Human. This GRIK2 GluR6) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
GRIK2 (GluR6) Polyclonal Antibody
ABP57333-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of GRIK2 GluR6) from Human. This GRIK2 GluR6) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
GRIK2 (GluR6) Polyclonal Antibody
ABP57333-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of GRIK2 GluR6) from Human. This GRIK2 GluR6) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
Anti-GRIK2 (GluR6) Antibody
A03374 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GRIK2 (GluR6) Antibody (GRIK2) detection. Tested with IHC in Human.
Anti-GRIK2 (GluR6) antibody
STJ97580 200 µl
EUR 197
Description: Rabbit polyclonal to GRIK2 (GluR6) (A240).
GluR6 Antibody
AF5460 200ul
EUR 304
Description: GluR6 Antibody detects endogenous levels of total GluR6.
GluR6 Antibody
ABF5460 100 ug
EUR 438
GluR6 antibody
70R-31210 100 ug
EUR 327
Description: Rabbit polyclonal GluR6 antibody
GluR6 Antibody
33389-100ul 100ul
EUR 252
GluR6 Antibody
33389-50ul 50ul
EUR 187
Polyclonal Grik2 Antibody
APC00057G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Grik2 . This antibody is tested and proven to work in the following applications:
GluR6 Conjugated Antibody
C33389 100ul
EUR 397
Anti-GluR6 Antibody
A06163 100ul
EUR 397
Description: Rabbit Polyclonal GluR6 Antibody. Validated in IHC, WB and tested in Mouse.
GRIK2 Rabbit pAb
A1939-100ul 100 ul
EUR 308
GRIK2 Rabbit pAb
A1939-200ul 200 ul
EUR 459
GRIK2 Rabbit pAb
A1939-20ul 20 ul
EUR 183
GRIK2 Rabbit pAb
A1939-50ul 50 ul
EUR 223
GRIK2 antibody
70R-5200 50 ug
EUR 467
Description: Rabbit polyclonal GRIK2 antibody raised against the C terminal of GRIK2
GRIK2 Antibody
ABD6706 100 ug
EUR 438
GRIK2 Antibody
32509-100ul 100ul
EUR 252
Grik2 Antibody
24602-100ul 100ul
EUR 390
GRIK2 antibody
70R-17601 50 ul
EUR 435
Description: Rabbit polyclonal GRIK2 antibody
GRIK2 antibody
70R-1522 100 ug
EUR 377
Description: Rabbit polyclonal GRIK2 antibody raised against the N terminal of GRIK2
GRIK2 antibody
70R-1530 100 ug
EUR 377
Description: Rabbit polyclonal GRIK2 antibody raised against the N terminal of GRIK2
GRIK2 Antibody
DF6706 200ul
EUR 304
Description: GRIK2 Antibody detects endogenous levels of total GRIK2.
GRIK2 Antibody
1-CSB-PA618751LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
GRIK2 Antibody
1-CSB-PA413776
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200
GRIK2 Antibody
1-CSB-PA009907GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Rabbit GRIK2 ELISA Kit
ERTG0263 96Tests
EUR 521
GluR6 Blocking Peptide
AF5460-BP 1mg
EUR 195
Glutamate Receptor 6 (GLUR6) Antibody
20-abx141648
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
GRIK2 Conjugated Antibody
C32509 100ul
EUR 397
anti- GRIK2 antibody
FNab03648 100µg
EUR 548.75
  • Immunogen: glutamate receptor, ionotropic, kainate 2
  • Uniprot ID: Q13002
  • Gene ID: 2898
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against GRIK2
Anti-GRIK2 antibody
PAab03648 100 ug
EUR 386
Anti-GRIK2 antibody
STJ23862 100 µl
EUR 277
Description: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. Mutations in this gene have been associated with autosomal recessive mental retardation.
Grik2/ Rat Grik2 ELISA Kit
ELI-31684r 96 Tests
EUR 886
GRIK2 siRNA
20-abx902315
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GRIK2 siRNA
20-abx918686
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GRIK2 siRNA
20-abx918687
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-GRIK2
YF-PA12125 50 ul
EUR 363
Description: Mouse polyclonal to GRIK2
GRIK2 Antibody, HRP conjugated
1-CSB-PA618751LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GRIK2 Antibody, FITC conjugated
1-CSB-PA618751LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GRIK2 Antibody, Biotin conjugated
1-CSB-PA618751LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against GRIK2. Recognizes GRIK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GRIK2 cloning plasmid
CSB-CL618751HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1062
  • Sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagat
  • Show more
Description: A cloning plasmid for the GRIK2 gene.
GRIK2 cloning plasmid
CSB-CL618751HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1752
  • Sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagat
  • Show more
Description: A cloning plasmid for the GRIK2 gene.
GRIK2 Blocking Peptide
33R-5447 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIK2 antibody, catalog no. 70R-1530
GRIK2 Blocking Peptide
33R-7009 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIK2 antibody, catalog no. 70R-1522
GRIK2 Blocking Peptide
33R-8980 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIK2 antibody, catalog no. 70R-5200
GRIK2 Blocking Peptide
DF6706-BP 1mg
EUR 195
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human)
4-PAC018Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2)
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), APC
4-PAC018Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with APC.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), Biotinylated
4-PAC018Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with Biotin.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), Cy3
4-PAC018Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with Cy3.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), FITC
4-PAC018Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with FITC.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), HRP
4-PAC018Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with HRP.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), PE
4-PAC018Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with PE.
Rat GRIK2 shRNA Plasmid
20-abx985800
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GRIK2 ELISA Kit
EHG0263 96Tests
EUR 521
Goat GRIK2 ELISA Kit
EGTG0263 96Tests
EUR 521
Canine GRIK2 ELISA Kit
ECG0263 96Tests
EUR 521
Bovine GRIK2 ELISA Kit
EBG0263 96Tests
EUR 521
Anserini GRIK2 ELISA Kit
EAG0263 96Tests
EUR 521
GRIK2 ELISA KIT|Human
EF009993 96 Tests
EUR 689
Porcine GRIK2 ELISA Kit
EPG0263 96Tests
EUR 521
Rat GRIK2 ELISA Kit
ERG0263 96Tests
EUR 521
Mouse GRIK2 ELISA Kit
EMG0263 96Tests
EUR 521
Mouse GRIK2 shRNA Plasmid
20-abx970663
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GRIK2 shRNA Plasmid
20-abx951952
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rabbit Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) ELISA Kit
abx363088-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) ELISA kit
E04G0397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) ELISA kit
E04G0397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) ELISA kit
E04G0397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor, ionotropic kainate 2(GRIK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Polyclonal Antibody (Human), APC-Cy7
4-PAC018Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIK2 (Asn286~Pro561)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2). This antibody is labeled with APC-Cy7.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
20-abx112746
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
20-abx130982
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
20-abx001584
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
abx028048-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
abx028048-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
20-abx323185
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
abx340079-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2) Antibody
abx233648-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Guinea Pig GRIK2 ELISA Kit
EGG0263 96Tests
EUR 521
GRIK2 ORF Vector (Human) (pORF)
ORF004677 1.0 ug DNA
EUR 95
GRIK2 ORF Vector (Human) (pORF)
ORF004678 1.0 ug DNA
EUR 95
Grik2 ORF Vector (Rat) (pORF)
ORF067884 1.0 ug DNA
EUR 506
Grik2 ORF Vector (Mouse) (pORF)
ORF046664 1.0 ug DNA
EUR 506
Grik2 ORF Vector (Mouse) (pORF)
ORF046665 1.0 ug DNA
EUR 506
GRIK2 ELISA Kit (Human) (OKEI00232)
OKEI00232 96 Wells
EUR 767
Description: Description of target: Ionotropic glutamate receptor. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist . May be involved in the transmission of light information from the retina to the hypothalamus. Modulates cell surface expression of NETO2.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
GRIK2 ELISA Kit (Rat) (OKEI00777)
OKEI00777 96 Wells
EUR 767
Description: Description of target: Ionotropic glutamate receptor. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist . May be involved in the transmission of light information from the retina to the hypothalamus. Modulates cell surface expression of NETO2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL
GRIK2 sgRNA CRISPR Lentivector set (Human)
K0906301 3 x 1.0 ug
EUR 339
Grik2 sgRNA CRISPR Lentivector set (Mouse)
K4502301 3 x 1.0 ug
EUR 339
Grik2 sgRNA CRISPR Lentivector set (Rat)
K6788901 3 x 1.0 ug
EUR 339
GRIK2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0906302 1.0 ug DNA
EUR 154
GRIK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0906303 1.0 ug DNA
EUR 154
GRIK2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0906304 1.0 ug DNA
EUR 154
Grik2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4502302 1.0 ug DNA
EUR 154
Grik2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4502303 1.0 ug DNA
EUR 154
Grik2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4502304 1.0 ug DNA
EUR 154
Grik2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6788902 1.0 ug DNA
EUR 154
Grik2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6788903 1.0 ug DNA
EUR 154
Grik2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6788904 1.0 ug DNA
EUR 154
Recombinant Glutamate Receptor, Ionotropic, Kainate 2 (GRIK2)
4-RPC018Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13002
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Glutamate Receptor, Ionotropic, Kainate 2 expressed in: E.coli
GRIK2 Protein Vector (Rat) (pPB-C-His)
PV271534 500 ng
EUR 1166
GRIK2 Protein Vector (Rat) (pPB-N-His)
PV271535 500 ng
EUR 1166
GRIK2 Protein Vector (Rat) (pPM-C-HA)
PV271536 500 ng
EUR 1166
GRIK2 Protein Vector (Rat) (pPM-C-His)
PV271537 500 ng
EUR 1166
GRIK2 Protein Vector (Human) (pPB-C-His)
PV018705 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPB-N-His)
PV018706 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPM-C-HA)
PV018707 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPM-C-His)
PV018708 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPB-C-His)
PV018709 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPB-N-His)
PV018710 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPM-C-HA)
PV018711 500 ng
EUR 329
GRIK2 Protein Vector (Human) (pPM-C-His)
PV018712 500 ng
EUR 329
GRIK2 Protein Vector (Mouse) (pPB-C-His)
PV186654 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPB-N-His)
PV186655 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPM-C-HA)
PV186656 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPM-C-His)
PV186657 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPB-C-His)
PV186658 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPB-N-His)
PV186659 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPM-C-HA)
PV186660 500 ng
EUR 1065
GRIK2 Protein Vector (Mouse) (pPM-C-His)
PV186661 500 ng
EUR 1065
Grik2 3'UTR Luciferase Stable Cell Line
TU205452 1.0 ml Ask for price
Grik2 3'UTR GFP Stable Cell Line
TU159108 1.0 ml Ask for price
GRIK2 3'UTR Luciferase Stable Cell Line
TU009315 1.0 ml
EUR 1521
Grik2 3'UTR Luciferase Stable Cell Line
TU109108 1.0 ml Ask for price
GRIK2 3'UTR GFP Stable Cell Line
TU059315 1.0 ml
EUR 1521
Grik2 3'UTR GFP Stable Cell Line
TU255452 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC