Order Now: brent@sdlifesciences.com
GABARAP Polyclonal Antibody |
ABP57489-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide of GABARAP
- Applications tips:
|
Description: A polyclonal antibody for detection of GABARAP from Human, Mouse, Rat. This GABARAP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of GABARAP |
GABARAP Polyclonal Antibody |
A51797 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GABARAP Rabbit pAb |
A12568-100ul |
Abclonal |
100 ul |
EUR 308 |
GABARAP Rabbit pAb |
A12568-200ul |
Abclonal |
200 ul |
EUR 459 |
GABARAP Rabbit pAb |
A12568-20ul |
Abclonal |
20 ul |
EUR 183 |
GABARAP Rabbit pAb |
A12568-50ul |
Abclonal |
50 ul |
EUR 223 |
GABARAP Rabbit pAb |
A5616-100ul |
Abclonal |
100 ul |
EUR 308 |
GABARAP Rabbit pAb |
A5616-200ul |
Abclonal |
200 ul |
EUR 459 |
GABARAP Rabbit pAb |
A5616-20ul |
Abclonal |
20 ul |
EUR 183 |
GABARAP Rabbit pAb |
A5616-50ul |
Abclonal |
50 ul |
EUR 223 |
GABARAP Rabbit mAb |
A4335-100ul |
Abclonal |
100 ul |
EUR 410 |
GABARAP Rabbit mAb |
A4335-200ul |
Abclonal |
200 ul |
EUR 571 |
GABARAP Rabbit mAb |
A4335-20ul |
Abclonal |
20 ul |
EUR 221 |
GABARAP Rabbit mAb |
A4335-50ul |
Abclonal |
50 ul |
EUR 287 |
GABARAP Rabbit pAb |
A13855-100ul |
Abclonal |
100 ul |
EUR 308 |
GABARAP Rabbit pAb |
A13855-200ul |
Abclonal |
200 ul |
EUR 459 |
GABARAP Rabbit pAb |
A13855-20ul |
Abclonal |
20 ul |
EUR 183 |
GABARAP Rabbit pAb |
A13855-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal GABARAP Antibody (N-term) |
APG03029G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GABARAP (N-term). This antibody is tested and proven to work in the following applications: |
GABARAP Polyclonal Antibody, HRP Conjugated |
A51798 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GABARAP Polyclonal Antibody, FITC Conjugated |
A51799 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
GABARAP Polyclonal Antibody, Biotin Conjugated |
A51800 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
GABARAP antibody |
70R-2213 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GABARAP antibody |
GABARAP antibody |
70R-GR028 |
Fitzgerald |
100 ug |
EUR 300 |
Description: Affinity purified Rabbit polyclonal GABARAP antibody |
GABARAP antibody |
70R-9080 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal GABARAP antibody |
GABARAP antibody |
70R-9625 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal GABARAP antibody |
GABARAP Antibody |
49642-100ul |
SAB |
100ul |
EUR 333 |
GABARAP Antibody |
49642-50ul |
SAB |
50ul |
EUR 239 |
GABARAP Antibody |
32924-100ul |
SAB |
100ul |
EUR 252 |
GABARAP antibody |
70R-17388 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GABARAP antibody |
GABARAP Antibody |
DF7419 |
Affbiotech |
200ul |
EUR 304 |
Description: GABARAP Antibody detects endogenous levels of total GABARAP. |
GABARAP Antibody |
1-CSB-PA009130GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
GABARAP Antibody |
1-CSB-PA05484A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:100-1:200 |
GABARAP Conjugated Antibody |
C49642 |
SAB |
100ul |
EUR 397 |
GABARAP Conjugated Antibody |
C32924 |
SAB |
100ul |
EUR 397 |
anti- GABARAP antibody |
FNab03274 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: GABA(A) receptor-associated protein
- Uniprot ID: O95166
- Gene ID: 11337
- Research Area: Neuroscience, Signal Transduction, Metabolism, Cancer
|
Description: Antibody raised against GABARAP |
Anti-GABARAP Antibody |
A01927 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for GABARAP Antibody (GABARAPL2) detection. Tested with WB in Human, Mouse, Rat. |
Human GABARAP Antibody |
33046-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-GABARAP antibody |
STJ98595 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to GABARAP. |
Anti-GABARAP antibody |
STJ27583 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. |
Anti-GABARAP antibody |
STJ114442 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. |
Anti-GABARAP antibody |
STJ115794 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. |
GABARAP siRNA |
20-abx902057 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GABARAP siRNA |
20-abx917412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GABARAP siRNA |
20-abx917413 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GABARAP |
YF-PA25792 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to GABARAP |
GABARAP recombinant monoclonal antibody |
A5209 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human GABARAP for WB, IHC,ELISA |
GABARAP Antibody, HRP conjugated |
1-CSB-PA05484B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GABARAP Antibody, FITC conjugated |
1-CSB-PA05484C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GABARAP Antibody, Biotin conjugated |
1-CSB-PA05484D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-GABARAP Monoclonal Antibody |
M01907 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal GABARAP Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Antibody for Human GABARAP |
SPC-620D |
Stressmarq |
0.1mg |
EUR 354 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated. |
Antibody for Human GABARAP |
SPC-620D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 390. |
Antibody for Human GABARAP |
SPC-620D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 488. |
Antibody for Human GABARAP |
SPC-620D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 565. |
Antibody for Human GABARAP |
SPC-620D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 594. |
Antibody for Human GABARAP |
SPC-620D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 633. |
Antibody for Human GABARAP |
SPC-620D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 655. |
Antibody for Human GABARAP |
SPC-620D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 680. |
Antibody for Human GABARAP |
SPC-620D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 700. |
Antibody for Human GABARAP |
SPC-620D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human GABARAP |
SPC-620D-APC |
Stressmarq |
0.1mg |
EUR 399 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC . |
Antibody for Human GABARAP |
SPC-620D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC/Cy7. |
Antibody for Human GABARAP |
SPC-620D-BI |
Stressmarq |
0.1mg |
EUR 396 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Biotin. |
Antibody for Human GABARAP |
SPC-620D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 350. |
Antibody for Human GABARAP |
SPC-620D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 405. |
Antibody for Human GABARAP |
SPC-620D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 488. |
Antibody for Human GABARAP |
SPC-620D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 594. |
Antibody for Human GABARAP |
SPC-620D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 633. |
Antibody for Human GABARAP |
SPC-620D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to FITC. |
Antibody for Human GABARAP |
SPC-620D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to HRP. |
Antibody for Human GABARAP |
SPC-620D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PE/ATTO 594. |
Antibody for Human GABARAP |
SPC-620D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PerCP. |
Antibody for Human GABARAP |
SPC-620D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to RPE . |
Antibody for Human GABARAP |
SPC-620D-STR |
Stressmarq |
0.1mg |
EUR 398 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Streptavidin. |
Antibody for Human GABARAP |
SPC-620S |
Stressmarq |
0.012mg |
EUR 65 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated. |
Antibody for Human GABARAP |
SPC-621D |
Stressmarq |
0.1mg |
EUR 354 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated. |
Antibody for Human GABARAP |
SPC-621D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 390. |
Antibody for Human GABARAP |
SPC-621D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 488. |
Antibody for Human GABARAP |
SPC-621D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 565. |
Antibody for Human GABARAP |
SPC-621D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 594. |
Antibody for Human GABARAP |
SPC-621D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 633. |
Antibody for Human GABARAP |
SPC-621D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 655. |
Antibody for Human GABARAP |
SPC-621D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 680. |
Antibody for Human GABARAP |
SPC-621D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 700. |
Antibody for Human GABARAP |
SPC-621D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human GABARAP |
SPC-621D-APC |
Stressmarq |
0.1mg |
EUR 399 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC . |
Antibody for Human GABARAP |
SPC-621D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC/Cy7. |
Antibody for Human GABARAP |
SPC-621D-BI |
Stressmarq |
0.1mg |
EUR 396 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Biotin. |
Antibody for Human GABARAP |
SPC-621D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 350. |
Antibody for Human GABARAP |
SPC-621D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 405. |
Antibody for Human GABARAP |
SPC-621D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 488. |
Antibody for Human GABARAP |
SPC-621D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 594. |
Antibody for Human GABARAP |
SPC-621D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 633. |
Antibody for Human GABARAP |
SPC-621D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to FITC. |
Antibody for Human GABARAP |
SPC-621D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to HRP. |
Antibody for Human GABARAP |
SPC-621D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PE/ATTO 594. |
Antibody for Human GABARAP |
SPC-621D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PerCP. |
Antibody for Human GABARAP |
SPC-621D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to RPE . |
Antibody for Human GABARAP |
SPC-621D-STR |
Stressmarq |
0.1mg |
EUR 398 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Streptavidin. |
Antibody for Human GABARAP |
SPC-621S |
Stressmarq |
0.012mg |
EUR 65 |
- Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
|
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated. |
GABA(A) receptor-associated protein (GABARAP) polyclonal antibody |
ABP-PAB-10146 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Neuroscience
- Brand:
|
GABARAP cloning plasmid |
CSB-CL009130HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 354
- Sequence: ATGAAGTTCGTGTACAAAGAAGAGCATCCGTTCGAGAAGCGCCGCTCTGAGGGCGAGAAGATCCGAAAGAAATACCCGGACCGGGTGCCGGTGATAGTAGAAAAGGCTCCCAAAGCTCGGATAGGAGACCTGGACAAAAAGAAATACCTGGTGCCTTCTGATCTCACAGTTGGTCA
- Show more
|
Description: A cloning plasmid for the GABARAP gene. |
GABARAP Blocking Peptide |
33R-3983 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-9625 |
GABARAP Blocking Peptide |
33R-4134 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-9080 |
GABARAP Blocking Peptide |
33R-4382 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-2213 |
GABARAP Blocking Peptide |
DF7419-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-GABARAP (1G7) |
YF-MA20508 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GABARAP |
Anti-GABARAP (4E12) |
YF-MA20509 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GABARAP |
Monoclonal GABARAP Antibody, Clone: 424CT5.1.6 |
APR11965G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human GABARAP. The antibodies are raised in Mouse and are from clone 424CT5.1.6. This antibody is applicable in WB, E |
Human GABARAP Antibody (Biotin Conjugate) |
33046-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal GABARAP Antibody(Ascites), Clone: 424CT5.1.6 |
APG03307G |
Leading Biology |
0.1 ml |
EUR 484 |
Description: A Monoclonal antibody against Human GABARAP(Ascites). The antibodies are raised in Mouse and are from clone 424CT5.1.6. This antibody is applicable in WB, E |
Human GABARAP AssayLite Antibody (FITC Conjugate) |
33046-05141 |
AssayPro |
150 ug |
EUR 428 |
Human GABARAP AssayLite Antibody (RPE Conjugate) |
33046-05151 |
AssayPro |
150 ug |
EUR 428 |
Human GABARAP AssayLite Antibody (APC Conjugate) |
33046-05161 |
AssayPro |
150 ug |
EUR 428 |
Human GABARAP AssayLite Antibody (PerCP Conjugate) |
33046-05171 |
AssayPro |
150 ug |
EUR 471 |
Mouse GABARAP shRNA Plasmid |
20-abx974803 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat GABARAP shRNA Plasmid |
20-abx985950 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GABARAP shRNA Plasmid |
20-abx957764 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GABARAP protein (His tag) |
80R-1246 |
Fitzgerald |
100 ug |
EUR 268 |
Description: Purified recombinant Human GABARAP protein |
Recombinant human GABARAP-a |
P1250 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: H6UMI1
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human GABARAP-a |
GABARAP Recombinant Protein (Human) |
RP039349 |
ABM |
100 ug |
Ask for price |
GABARAP Recombinant Protein (Rat) |
RP202025 |
ABM |
100 ug |
Ask for price |
GABARAP Recombinant Protein (Mouse) |
RP135647 |
ABM |
100 ug |
Ask for price |
GABA-A Receptor Associated Protein (GABARAP) Antibody |
20-abx112650 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GABA-A Receptor Associated Protein (GABARAP) Antibody |
20-abx109803 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GABA-A Receptor Associated Protein (GABARAP) Antibody |
20-abx141778 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
GABA-A Receptor Associated Protein (GABARAP) Antibody |
20-abx004293 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GABA-A Receptor Associated Protein (GABARAP) Antibody |
abx030109-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GABA-A Receptor Associated Protein (GABARAP) Antibody |
abx030109-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|