GABARAP Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

GABARAP Polyclonal Antibody
ES8482-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GABARAP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GABARAP Polyclonal Antibody
ES8482-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GABARAP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GABARAP Rabbit pAb
A13855-100ul 100 ul
EUR 308

GABARAP Rabbit pAb
A13855-200ul 200 ul
EUR 459

GABARAP Rabbit pAb
A13855-20ul 20 ul
EUR 183

GABARAP Rabbit pAb
A13855-50ul 50 ul
EUR 223

GABARAP Rabbit pAb
A12568-100ul 100 ul
EUR 308

GABARAP Rabbit pAb
A12568-200ul 200 ul
EUR 459

GABARAP Rabbit pAb
A12568-20ul 20 ul
EUR 183

GABARAP Rabbit pAb
A12568-50ul 50 ul
EUR 223

GABARAP Rabbit mAb
A4335-100ul 100 ul
EUR 410

GABARAP Rabbit mAb
A4335-200ul 200 ul
EUR 571

GABARAP Rabbit mAb
A4335-20ul 20 ul
EUR 221

GABARAP Rabbit mAb
A4335-50ul 50 ul
EUR 287

GABARAP Rabbit pAb
A5616-100ul 100 ul
EUR 308

GABARAP Rabbit pAb
A5616-200ul 200 ul
EUR 459

GABARAP Rabbit pAb
A5616-20ul 20 ul
EUR 183

GABARAP Rabbit pAb
A5616-50ul 50 ul
EUR 223

Polyclonal GABARAP Antibody (N-term)
APG03029G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GABARAP (N-term). This antibody is tested and proven to work in the following applications:

GABARAP Polyclonal Antibody, HRP Conjugated
A51798 100 µg
EUR 570.55
Description: reagents widely cited

GABARAP Polyclonal Antibody, FITC Conjugated
A51799 100 µg
EUR 570.55
Description: Ask the seller for details

GABARAP Polyclonal Antibody, Biotin Conjugated
A51800 100 µg
EUR 570.55
Description: The best epigenetics products

GABARAP antibody
70R-17388 50 ul
EUR 435
Description: Rabbit polyclonal GABARAP antibody

GABARAP antibody
70R-2213 50 ug
EUR 467
Description: Rabbit polyclonal GABARAP antibody

GABARAP Antibody
32924-100ul 100ul
EUR 252

GABARAP Antibody
49642-100ul 100ul
EUR 333

GABARAP Antibody
49642-50ul 50ul
EUR 239

GABARAP Antibody
1-CSB-PA05484A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:100-1:200

GABARAP Antibody
DF7419 200ul
EUR 304
Description: GABARAP Antibody detects endogenous levels of total GABARAP.

GABARAP antibody
70R-GR028 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal GABARAP antibody

GABARAP antibody
70R-9080 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GABARAP antibody

GABARAP antibody
70R-9625 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GABARAP antibody

GABARAP Antibody
1-CSB-PA009130GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GABARAP Antibody
ABD7419 100 ug
EUR 438

Human GABARAP Antibody
33046-05111 150 ug
EUR 261

Anti-GABARAP Antibody
A01927 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GABARAP Antibody (GABARAPL2) detection. Tested with WB in Human, Mouse, Rat.

GABARAP Conjugated Antibody
C49642 100ul
EUR 397

GABARAP Conjugated Antibody
C32924 100ul
EUR 397

anti- GABARAP antibody
FNab03274 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: GABA(A) receptor-associated protein
  • Uniprot ID: O95166
  • Gene ID: 11337
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Cancer
Description: Antibody raised against GABARAP

Anti-GABARAP antibody
PAab03274 100 ug
EUR 386

Anti-GABARAP antibody
STJ27583 100 µl
EUR 277
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton.

Anti-GABARAP antibody
STJ114442 100 µl
EUR 277
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton.

Anti-GABARAP antibody
STJ115794 100 µl
EUR 277
Description: Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton.

Anti-GABARAP antibody
STJ98595 200 µl
EUR 197
Description: Rabbit polyclonal to GABARAP.

GABARAP siRNA
20-abx902057
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GABARAP siRNA
20-abx917412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GABARAP siRNA
20-abx917413
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GABARAP
YF-PA25792 50 ul
EUR 334
Description: Mouse polyclonal to GABARAP

GABARAP Antibody, HRP conjugated
1-CSB-PA05484B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GABARAP Antibody, FITC conjugated
1-CSB-PA05484C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GABARAP Antibody, Biotin conjugated
1-CSB-PA05484D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GABARAP. Recognizes GABARAP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GABARAP recombinant monoclonal antibody
A5209 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human GABARAP for WB, IHC,ELISA

Anti-GABARAP Monoclonal Antibody
M01907 100ug
EUR 397
Description: Rabbit Monoclonal GABARAP Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Antibody for Human GABARAP
SPC-620D 0.1mg
EUR 354
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

Antibody for Human GABARAP
SPC-620D-A390 0.1mg
EUR 401
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 390.

Antibody for Human GABARAP
SPC-620D-A488 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 488.

Antibody for Human GABARAP
SPC-620D-A565 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 565.

Antibody for Human GABARAP
SPC-620D-A594 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 594.

Antibody for Human GABARAP
SPC-620D-A633 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 633.

Antibody for Human GABARAP
SPC-620D-A655 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 655.

Antibody for Human GABARAP
SPC-620D-A680 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 680.

Antibody for Human GABARAP
SPC-620D-A700 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 700.

Antibody for Human GABARAP
SPC-620D-ALP 0.1mg
EUR 394
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GABARAP
SPC-620D-APC 0.1mg
EUR 399
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC .

Antibody for Human GABARAP
SPC-620D-APCCY7 0.1mg
EUR 471
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC/Cy7.

Antibody for Human GABARAP
SPC-620D-BI 0.1mg
EUR 396
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Biotin.

Antibody for Human GABARAP
SPC-620D-DY350 0.1mg
EUR 414
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 350.

Antibody for Human GABARAP
SPC-620D-DY405 0.1mg
EUR 403
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 405.

Antibody for Human GABARAP
SPC-620D-DY488 0.1mg
EUR 393
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 488.

Antibody for Human GABARAP
SPC-620D-DY594 0.1mg
EUR 395
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 594.

Antibody for Human GABARAP
SPC-620D-DY633 0.1mg
EUR 390
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 633.

Antibody for Human GABARAP
SPC-620D-FITC 0.1mg
EUR 392
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to FITC.

Antibody for Human GABARAP
SPC-620D-HRP 0.1mg
EUR 388
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to HRP.

Antibody for Human GABARAP
SPC-620D-P594 0.1mg
EUR 407
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PE/ATTO 594.

Antibody for Human GABARAP
SPC-620D-PCP 0.1mg
EUR 399
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PerCP.

Antibody for Human GABARAP
SPC-620D-RPE 0.1mg
EUR 397
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to RPE .

Antibody for Human GABARAP
SPC-620D-STR 0.1mg
EUR 398
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Streptavidin.

Antibody for Human GABARAP
SPC-620S 0.012mg
EUR 65
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

Antibody for Human GABARAP
SPC-621D 0.1mg
EUR 354
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

Antibody for Human GABARAP
SPC-621D-A390 0.1mg
EUR 401
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 390.

Antibody for Human GABARAP
SPC-621D-A488 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 488.

Antibody for Human GABARAP
SPC-621D-A565 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 565.

Antibody for Human GABARAP
SPC-621D-A594 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 594.

Antibody for Human GABARAP
SPC-621D-A633 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 633.

Antibody for Human GABARAP
SPC-621D-A655 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 655.

Antibody for Human GABARAP
SPC-621D-A680 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 680.

Antibody for Human GABARAP
SPC-621D-A700 0.1mg
EUR 400
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to ATTO 700.

Antibody for Human GABARAP
SPC-621D-ALP 0.1mg
EUR 394
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Alkaline Phosphatase.

Antibody for Human GABARAP
SPC-621D-APC 0.1mg
EUR 399
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC .

Antibody for Human GABARAP
SPC-621D-APCCY7 0.1mg
EUR 471
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to APC/Cy7.

Antibody for Human GABARAP
SPC-621D-BI 0.1mg
EUR 396
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Biotin.

Antibody for Human GABARAP
SPC-621D-DY350 0.1mg
EUR 414
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 350.

Antibody for Human GABARAP
SPC-621D-DY405 0.1mg
EUR 403
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 405.

Antibody for Human GABARAP
SPC-621D-DY488 0.1mg
EUR 393
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 488.

Antibody for Human GABARAP
SPC-621D-DY594 0.1mg
EUR 395
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 594.

Antibody for Human GABARAP
SPC-621D-DY633 0.1mg
EUR 390
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Dylight 633.

Antibody for Human GABARAP
SPC-621D-FITC 0.1mg
EUR 392
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to FITC.

Antibody for Human GABARAP
SPC-621D-HRP 0.1mg
EUR 388
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to HRP.

Antibody for Human GABARAP
SPC-621D-P594 0.1mg
EUR 407
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PE/ATTO 594.

Antibody for Human GABARAP
SPC-621D-PCP 0.1mg
EUR 399
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to PerCP.

Antibody for Human GABARAP
SPC-621D-RPE 0.1mg
EUR 397
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to RPE .

Antibody for Human GABARAP
SPC-621D-STR 0.1mg
EUR 398
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is conjugated to Streptavidin.

Antibody for Human GABARAP
SPC-621S 0.012mg
EUR 65
  • Gamma-aminobutyric acid receptor-associated protein, or GABARAP, are lighand gated chloride channels that mediate inhibitory neurotransmission. It clusters neurotransmitter receptors by mediating its interaction with the cytoskeleton (1).
Description: A polyclonal antibody for GABARAP from Human | Mouse . The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human GABARAP. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This GABARAP antibody is unconjugated.

GABA(A) receptor-associated protein (GABARAP) polyclonal antibody
ABP-PAB-10146 100 ug Ask for price
    • Product line: Neuroscience
    • Brand:

GABARAP Blocking Peptide
33R-3983 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-9625

GABARAP Blocking Peptide
33R-4134 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-9080

GABARAP Blocking Peptide
33R-4382 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GABARAP antibody, catalog no. 70R-2213

GABARAP Blocking Peptide
DF7419-BP 1mg
EUR 195

GABARAP cloning plasmid
CSB-CL009130HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 354
  • Sequence: ATGAAGTTCGTGTACAAAGAAGAGCATCCGTTCGAGAAGCGCCGCTCTGAGGGCGAGAAGATCCGAAAGAAATACCCGGACCGGGTGCCGGTGATAGTAGAAAAGGCTCCCAAAGCTCGGATAGGAGACCTGGACAAAAAGAAATACCTGGTGCCTTCTGATCTCACAGTTGGTCA
  • Show more
Description: A cloning plasmid for the GABARAP gene.

pDONR223-GABARAP Plasmid
PVTB00829 2 ug
EUR 356

Anti-GABARAP (1G7)
YF-MA20508 100 ug
EUR 363
Description: Mouse monoclonal to GABARAP

Anti-GABARAP (4E12)
YF-MA20509 100 ug
EUR 363
Description: Mouse monoclonal to GABARAP

Human GABARAP Antibody (Biotin Conjugate)
33046-05121 150 ug
EUR 369

Monoclonal GABARAP Antibody, Clone: 424CT5.1.6
APR11965G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human GABARAP. The antibodies are raised in Mouse and are from clone 424CT5.1.6. This antibody is applicable in WB, E

Human GABARAP AssayLite Antibody (FITC Conjugate)
33046-05141 150 ug
EUR 428

Human GABARAP AssayLite Antibody (RPE Conjugate)
33046-05151 150 ug
EUR 428

Human GABARAP AssayLite Antibody (APC Conjugate)
33046-05161 150 ug
EUR 428

Human GABARAP AssayLite Antibody (PerCP Conjugate)
33046-05171 150 ug
EUR 471

Monoclonal GABARAP Antibody(Ascites), Clone: 424CT5.1.6
APG03307G 0.1 ml
EUR 484
Description: A Monoclonal antibody against Human GABARAP(Ascites). The antibodies are raised in Mouse and are from clone 424CT5.1.6. This antibody is applicable in WB, E

GABARAP protein (His tag)
80R-1246 100 ug
EUR 268
Description: Purified recombinant Human GABARAP protein

GABARAP ELISA KIT|Human
EF009735 96 Tests
EUR 689

Mouse GABARAP shRNA Plasmid
20-abx974803
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GABARAP shRNA Plasmid
20-abx985950
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GABARAP shRNA Plasmid
20-abx957764
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant human GABARAP-a
P1250 100ug Ask for price
  • Uniprot ID: H6UMI1
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GABARAP-a

GABARAP Recombinant Protein (Human)
RP039349 100 ug Ask for price

GABARAP Recombinant Protein (Rat)
RP202025 100 ug Ask for price

GABARAP Recombinant Protein (Mouse)
RP135647 100 ug Ask for price

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx004293
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx112650
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx109803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
20-abx141778
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx030109-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GABA-A Receptor Associated Protein (GABARAP) Antibody
abx030109-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.