FAM48A Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

FAM48A Polyclonal Antibody

ABP57553-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 231-280
  • Applications tips:
Description: A polyclonal antibody for detection of FAM48A from Human, Mouse, Rat. This FAM48A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 231-280

Fam48a/ Rat Fam48a ELISA Kit

ELI-09774r 96 Tests
EUR 886

anti- FAM48A antibody

FNab02986 100µg
EUR 585
  • Immunogen: family with sequence similarity 48, member A
  • Uniprot ID: Q8NEM7
  • Research Area: Developmental biology
Description: Antibody raised against FAM48A

Anti-FAM48A Antibody

A11433 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for FAM48A Antibody (SUPT20H) detection. Tested with WB in Human, Mouse, Rat.

Anti-FAM48A antibody

PAab02986 100 ug
EUR 412

Anti-FAM48A antibody

STJ98659 200 µl
EUR 197
Description: Rabbit polyclonal to FAM48A.

Human Protein FAM48A, FAM48A ELISA KIT

ELI-09807h 96 Tests
EUR 824

Chicken Protein FAM48A, FAM48A ELISA KIT

ELI-47764c 96 Tests
EUR 928

Mouse Protein FAM48A, Fam48a ELISA KIT

ELI-47765m 96 Tests
EUR 865

FAM48A cloning plasmid

CSB-CL818775HU-10ug 10ug
EUR 765
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2340
  • Sequence: atgcaacaagctttagaactagctttggatcgtgcagagtatgtcattgaaagtgcccgacagagacctcctaaaaggaaatacctatcaagtggaagaaaatctgtatttcaaaaactttatgacttgtatattgaagaatgtgaaaaagaacctgaagttaagaaattaagaa
  • Show more
Description: A cloning plasmid for the FAM48A gene.


EF009537 96 Tests
EUR 689

FAM48A Recombinant Protein (Human)

RP011569 100 ug Ask for price

FAM48A Recombinant Protein (Rat)

RP200663 100 ug Ask for price

FAM48A Recombinant Protein (Mouse)

RP133427 100 ug Ask for price

FAM48A ORF Vector (Human) (pORF)

ORF003857 1.0 ug DNA
EUR 95