Order Now: brent@sdlifesciences.com
FAM3D Polyclonal Antibody |
ABP57503-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170 |
FAM3D Polyclonal Antibody |
ABP57503-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170 |
FAM3D Polyclonal Antibody |
ABP57503-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170 |
FAM3D Polyclonal Antibody |
ABP53761-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human FAM3D
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FAM3D |
FAM3D Polyclonal Antibody |
ABP53761-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human FAM3D
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FAM3D |
FAM3D Polyclonal Antibody |
ABP53761-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human FAM3D
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human FAM3D |
FAM3D Rabbit pAb |
A17823-100ul |
Abclonal |
100 ul |
EUR 308 |
FAM3D Rabbit pAb |
A17823-200ul |
Abclonal |
200 ul |
EUR 459 |
FAM3D Rabbit pAb |
A17823-20ul |
Abclonal |
20 ul |
EUR 183 |
FAM3D Rabbit pAb |
A17823-50ul |
Abclonal |
50 ul |
EUR 223 |
FAM3D Rabbit pAb |
A17824-100ul |
Abclonal |
100 ul |
EUR 308 |
FAM3D Rabbit pAb |
A17824-200ul |
Abclonal |
200 ul |
EUR 459 |
FAM3D Rabbit pAb |
A17824-20ul |
Abclonal |
20 ul |
EUR 183 |
FAM3D Rabbit pAb |
A17824-50ul |
Abclonal |
50 ul |
EUR 223 |
FAM3D antibody |
70R-4572 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FAM3D antibody raised against the middle region of FAM3D |
FAM3D Antibody |
35324-100ul |
SAB |
100ul |
EUR 252 |
FAM3D Antibody |
35324-50ul |
SAB |
50ul |
EUR 187 |
FAM3D Antibody |
42987-100ul |
SAB |
100ul |
EUR 252 |
FAM3D antibody |
70R-17221 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FAM3D antibody |
FAM3D Antibody |
DF4832 |
Affbiotech |
200ul |
EUR 304 |
Description: FAM3D Antibody detects endogenous levels of total FAM3D. |
FAM3D Antibody |
1-CSB-PA007145 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
FAM3D Antibody |
1-CSB-PA008229GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FAM3D Antibody |
1-CSB-PA834780 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
FAM3D Antibody |
CSB-PA586397- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
FAM3D Antibody |
CSB-PA586397-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
FAM3D Conjugated Antibody |
C35324 |
SAB |
100ul |
EUR 397 |
anti- FAM3D antibody |
FNab02983 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: family with sequence similarity 3, member D
- Uniprot ID: Q96BQ1
- Gene ID: 131177
- Research Area: Cell Division and Proliferation, Signal Transduction
|
Description: Antibody raised against FAM3D |
Anti-FAM3D antibody |
STJ93036 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to FAM3D. |
Anti-FAM3D antibody |
STJ98609 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to FAM3D. |
Mouse FAM3D(Protein FAM3D) ELISA Kit |
EM1709 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 1.56-100 pg/ml
- Alias: FAM3D/Protein FAM3D/EF7/ OIT1/ cytokine-like protein EF-7/ family with sequence similarity 3, member D/ family with sequence similarity 3 member D
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938pg/ml |
Human Protein FAM3D (FAM3D) ELISA Kit |
abx387274-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein FAM3D(FAM3D) ELISA kit |
CSB-EL008229HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein FAM3D(FAM3D) ELISA kit |
1-CSB-EL008229HU |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Protein FAM3D(FAM3D) ELISA kit |
CSB-EL008229MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Protein FAM3D(FAM3D) ELISA kit |
1-CSB-EL008229MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
FAM3D siRNA |
20-abx916320 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAM3D siRNA |
20-abx916321 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FAM3D |
YF-PA22196 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FAM3D |
anti-FAM3D |
YF-PA22198 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FAM3D |
Mouse FAM3D (Protein FAM3D) ELISA Kit (CUSTOM) |
ELI-20793m |
Lifescience Market |
96 Tests |
EUR 100 |
FAM3D ELISA Kit| Mouse Protein FAM3D ELISA Kit |
EF014065 |
Lifescience Market |
96 Tests |
EUR 689 |
FAM3D Blocking Peptide |
33R-5499 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM3D antibody, catalog no. 70R-4572 |
FAM3D cloning plasmid |
CSB-CL856903HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 675
- Sequence: atgagagtgtcaggtgtgcttcgcctcctggccctcatctttgccatagtcacgacatggatgtttattcgaagctacatgagcttcagcatgaaaaccatccgtctgccacgctggctggcagcctcgcccaccaaggagatccaggttaaaaagtacaagtgtggcctcatcaa
- Show more
|
Description: A cloning plasmid for the FAM3D gene. |
FAM3D Blocking Peptide |
DF4832-BP |
Affbiotech |
1mg |
EUR 195 |
Human FAM3D shRNA Plasmid |
20-abx965057 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse FAM3D shRNA Plasmid |
20-abx971862 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FAM3D Recombinant Protein (Human) |
RP011536 |
ABM |
100 ug |
Ask for price |
FAM3D Recombinant Protein (Rat) |
RP200642 |
ABM |
100 ug |
Ask for price |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human) |
4-PAK368Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D) |
FAM3D ORF Vector (Human) (pORF) |
ORF003846 |
ABM |
1.0 ug DNA |
EUR 95 |
Fam3d ORF Vector (Rat) (pORF) |
ORF066882 |
ABM |
1.0 ug DNA |
EUR 506 |
FAM3D ELISA Kit (Human) (OKCA01454) |
OKCA01454 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL |
FAM3D ELISA Kit (Human) (OKEH08044) |
OKEH08044 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.28ng/mL |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC |
4-PAK368Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC. |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Biotinylated |
4-PAK368Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Biotin. |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Cy3 |
4-PAK368Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Cy3. |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), FITC |
4-PAK368Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with FITC. |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), HRP |
4-PAK368Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with HRP. |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), PE |
4-PAK368Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with PE. |
Recombinant Human Protein FAM3D (C-6His) |
C344-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Protein FAM3D (C-6His) |
C344-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Protein FAM3D (C-6His) |
C344-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Protein FAM3D (C-6His) |
C344-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
FAM3D sgRNA CRISPR Lentivector set (Human) |
K0712701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fam3d sgRNA CRISPR Lentivector set (Rat) |
K6602501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC-Cy7 |
4-PAK368Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FAM3D (Tyr26~Phe224)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC-Cy7. |
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
20-abx112443 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
20-abx129045 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
20-abx015204 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
20-abx324601 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
20-abx324989 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
abx340136-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
abx330731-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Family With Sequence Similarity 3, Member D (FAM3D) Antibody |
abx232983-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
FAM3D sgRNA CRISPR Lentivector (Human) (Target 1) |
K0712702 |
ABM |
1.0 ug DNA |
EUR 154 |
FAM3D sgRNA CRISPR Lentivector (Human) (Target 2) |
K0712703 |
ABM |
1.0 ug DNA |
EUR 154 |
FAM3D sgRNA CRISPR Lentivector (Human) (Target 3) |
K0712704 |
ABM |
1.0 ug DNA |
EUR 154 |
Fam3d sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6602502 |
ABM |
1.0 ug DNA |
EUR 154 |
Fam3d sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6602503 |
ABM |
1.0 ug DNA |
EUR 154 |
Fam3d sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6602504 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human FAM3D Protein, His, E.coli-10ug |
QP11847-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human FAM3D Protein, His, E.coli-1mg |
QP11847-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human FAM3D Protein, His, E.coli-2ug |
QP11847-2ug |
EnQuireBio |
2ug |
EUR 155 |
FAM3D Protein Vector (Human) (pPB-C-His) |
PV015381 |
ABM |
500 ng |
EUR 329 |
FAM3D Protein Vector (Human) (pPB-N-His) |
PV015382 |
ABM |
500 ng |
EUR 329 |
FAM3D Protein Vector (Human) (pPM-C-HA) |
PV015383 |
ABM |
500 ng |
EUR 329 |
FAM3D Protein Vector (Human) (pPM-C-His) |
PV015384 |
ABM |
500 ng |
EUR 329 |
FAM3D Protein Vector (Rat) (pPB-C-His) |
PV267526 |
ABM |
500 ng |
EUR 603 |
FAM3D Protein Vector (Rat) (pPB-N-His) |
PV267527 |
ABM |
500 ng |
EUR 603 |
FAM3D Protein Vector (Rat) (pPM-C-HA) |
PV267528 |
ABM |
500 ng |
EUR 603 |
FAM3D Protein Vector (Rat) (pPM-C-His) |
PV267529 |
ABM |
500 ng |
EUR 603 |
Fam3d 3'UTR Luciferase Stable Cell Line |
TU204364 |
ABM |
1.0 ml |
Ask for price |
FAM3D 3'UTR Luciferase Stable Cell Line |
TU007223 |
ABM |
1.0 ml |
EUR 1394 |
FAM3D 3'UTR GFP Stable Cell Line |
TU057223 |
ABM |
1.0 ml |
EUR 1394 |
Fam3d 3'UTR GFP Stable Cell Line |
TU254364 |
ABM |
1.0 ml |
Ask for price |
FAM3D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV651847 |
ABM |
1.0 ug DNA |
EUR 514 |
FAM3D Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV651851 |
ABM |
1.0 ug DNA |
EUR 514 |
FAM3D Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV651852 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |