FAM3D Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

FAM3D Polyclonal Antibody

ABP57503-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody

ABP57503-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from FAM3D at AA range: 121-170
  • Applications tips:
Description: A polyclonal antibody for detection of FAM3D from Human. This FAM3D antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from FAM3D at AA range: 121-170

FAM3D Polyclonal Antibody

ES8496-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM3D Polyclonal Antibody

ES8496-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM3D Polyclonal Antibody

ES4760-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FAM3D Polyclonal Antibody

ES4760-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM3D from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FAM3D Rabbit pAb

A17823-100ul 100 ul
EUR 308

FAM3D Rabbit pAb

A17823-200ul 200 ul
EUR 459

FAM3D Rabbit pAb

A17823-20ul 20 ul
EUR 183

FAM3D Rabbit pAb

A17823-50ul 50 ul
EUR 223

FAM3D Rabbit pAb

A17824-100ul 100 ul
EUR 308

FAM3D Rabbit pAb

A17824-200ul 200 ul
EUR 459

FAM3D Rabbit pAb

A17824-20ul 20 ul
EUR 183

FAM3D Rabbit pAb

A17824-50ul 50 ul
EUR 223

FAM3D antibody

70R-17221 50 ul
EUR 435
Description: Rabbit polyclonal FAM3D antibody

FAM3D Antibody

35324-100ul 100ul
EUR 252

FAM3D Antibody

35324-50ul 50ul
EUR 187

FAM3D Antibody

42987-100ul 100ul
EUR 252

FAM3D Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

FAM3D Antibody

DF4832 200ul
EUR 304
Description: FAM3D Antibody detects endogenous levels of total FAM3D.

FAM3D Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FAM3D Antibody

CSB-PA586397-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FAM3D antibody

70R-4572 50 ug
EUR 467
Description: Rabbit polyclonal FAM3D antibody raised against the middle region of FAM3D

FAM3D Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

FAM3D Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FAM3D. Recognizes FAM3D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FAM3D Antibody

ABD4832 100 ug
EUR 438

FAM3D Conjugated Antibody

C35324 100ul
EUR 397

anti- FAM3D antibody

FNab02983 100µg
EUR 548.75
  • Immunogen: family with sequence similarity 3, member D
  • Uniprot ID: Q96BQ1
  • Gene ID: 131177
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against FAM3D

Anti-FAM3D antibody

PAab02983 100 ug
EUR 386

Anti-FAM3D antibody

STJ119847 100 µl
EUR 277

Anti-FAM3D antibody

STJ119848 100 µl
EUR 277

Anti-FAM3D antibody

STJ93036 200 µl
EUR 197
Description: Rabbit polyclonal to FAM3D.

Anti-FAM3D antibody

STJ98609 200 µl
EUR 197
Description: Rabbit polyclonal to FAM3D.

Human Protein FAM3D(FAM3D) ELISA kit

CSB-EL008229HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein FAM3D(FAM3D) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein FAM3D(FAM3D) ELISA kit

CSB-EL008229MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D (FAM3D) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein FAM3D(FAM3D) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3D(FAM3D) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein FAM3D (FAM3D) ELISA Kit

abx387274-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse FAM3D(Protein FAM3D) ELISA Kit

EM1709 96T
EUR 567.6
  • Detection range: 1.56-100 pg/ml
  • Alias: FAM3D/Protein FAM3D/EF7/ OIT1/ cytokine-like protein EF-7/ family with sequence similarity 3, member D/ family with sequence similarity 3 member D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938pg/ml

Human FAM3D (Protein FAM3D) ELISA Kit

ELI-47388h 96 Tests
EUR 720


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22196 50 ul
EUR 363
Description: Mouse polyclonal to FAM3D


YF-PA22198 50 ug
EUR 363
Description: Mouse polyclonal to FAM3D

Mouse FAM3D (Protein FAM3D) ELISA Kit (CUSTOM)

ELI-20793m 96 Tests
EUR 100

FAM3D ELISA Kit| Mouse Protein FAM3D ELISA Kit

EF014065 96 Tests
EUR 689

FAM3D Blocking Peptide

33R-5499 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM3D antibody, catalog no. 70R-4572

FAM3D Blocking Peptide

DF4832-BP 1mg
EUR 195

FAM3D cloning plasmid

CSB-CL856903HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: atgagagtgtcaggtgtgcttcgcctcctggccctcatctttgccatagtcacgacatggatgtttattcgaagctacatgagcttcagcatgaaaaccatccgtctgccacgctggctggcagcctcgcccaccaaggagatccaggttaaaaagtacaagtgtggcctcatcaa
  • Show more
Description: A cloning plasmid for the FAM3D gene.


PVT13518 2 ug
EUR 391


EF009534 96 Tests
EUR 689

Human FAM3D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FAM3D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FAM3D Recombinant Protein (Human)

RP011536 100 ug Ask for price

FAM3D Recombinant Protein (Rat)

RP200642 100 ug Ask for price

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D)

Fam3d ORF Vector (Rat) (pORF)

ORF066882 1.0 ug DNA
EUR 506

FAM3D ORF Vector (Human) (pORF)

ORF003846 1.0 ug DNA
EUR 95

FAM3D ELISA Kit (Human) (OKCA01454)

OKCA01454 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

FAM3D ELISA Kit (Human) (OKEH08044)

OKEH08044 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.28ng/mL

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Biotin.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with Cy3.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with FITC.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with HRP.

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with PE.

Recombinant Human Protein FAM3D (C-6His)

C344-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)

C344-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)

C344-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Protein FAM3D (C-6His)

C344-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

FAM3D sgRNA CRISPR Lentivector set (Human)

K0712701 3 x 1.0 ug
EUR 339

Fam3d sgRNA CRISPR Lentivector set (Rat)

K6602501 3 x 1.0 ug
EUR 339

Family With Sequence Similarity 3, Member D (FAM3D) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FAM3D (Tyr26~Phe224)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Family With Sequence Similarity 3, Member D (FAM3D). This antibody is labeled with APC-Cy7.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

abx340136-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

abx330731-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Family With Sequence Similarity 3, Member D (FAM3D) Antibody

abx232983-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FAM3D sgRNA CRISPR Lentivector (Human) (Target 1)

K0712702 1.0 ug DNA
EUR 154

FAM3D sgRNA CRISPR Lentivector (Human) (Target 2)

K0712703 1.0 ug DNA
EUR 154

FAM3D sgRNA CRISPR Lentivector (Human) (Target 3)

K0712704 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 1)

K6602502 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 2)

K6602503 1.0 ug DNA
EUR 154

Fam3d sgRNA CRISPR Lentivector (Rat) (Target 3)

K6602504 1.0 ug DNA
EUR 154

FAM3D Protein Vector (Rat) (pPB-C-His)

PV267526 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPB-N-His)

PV267527 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPM-C-HA)

PV267528 500 ng
EUR 603

FAM3D Protein Vector (Rat) (pPM-C-His)

PV267529 500 ng
EUR 603

FAM3D Protein Vector (Human) (pPB-C-His)

PV015381 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPB-N-His)

PV015382 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPM-C-HA)

PV015383 500 ng
EUR 329

FAM3D Protein Vector (Human) (pPM-C-His)

PV015384 500 ng
EUR 329

Recombinant Human FAM3D Protein, His, E.coli-10ug

QP11847-10ug 10ug
EUR 201