ERLIN1/2 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

ERLIN1/2 Polyclonal Antibody

ABP57514-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80

ERLIN1/2 Polyclonal Antibody

ABP57514-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80

ERLIN1/2 Polyclonal Antibody

ES8507-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ERLIN1/2 Polyclonal Antibody

ES8507-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ERLIN1/2 Polyclonal Conjugated Antibody

C46738 100ul
EUR 397

ERLIN1 Polyclonal Antibody

28725-100ul 100ul
EUR 252

ERLIN1 Polyclonal Antibody

28725-50ul 50ul
EUR 187

ERLIN1 Polyclonal Antibody

A58954 100 µg
EUR 570.55
Description: reagents widely cited

ERLIN1 Rabbit pAb

A4440-100ul 100 ul
EUR 308

ERLIN1 Rabbit pAb

A4440-200ul 200 ul
EUR 459

ERLIN1 Rabbit pAb

A4440-20ul 20 ul Ask for price

ERLIN1 Rabbit pAb

A4440-50ul 50 ul Ask for price

ERLIN1 Rabbit pAb

A14843-100ul 100 ul
EUR 308

ERLIN1 Rabbit pAb

A14843-200ul 200 ul
EUR 459

ERLIN1 Rabbit pAb

A14843-20ul 20 ul
EUR 183

ERLIN1 Rabbit pAb

A14843-50ul 50 ul
EUR 223

ERLIN1 Polyclonal Conjugated Antibody

C32000 100ul
EUR 397

ERLIN1 Polyclonal Conjugated Antibody

C28725 100ul
EUR 397

Anti-ERLIN1/2 Antibody

A08034-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ERLIN1/2 Antibody (ERLIN1) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-ERLIN1/2 antibody

STJ98620 200 µl
EUR 197
Description: Rabbit polyclonal to ERLIN1/2.

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

DLR-ERLIN1-Hu-48T 48T
EUR 554
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

DLR-ERLIN1-Hu-96T 96T
EUR 725
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RDR-ERLIN1-Hu-48Tests 48 Tests
EUR 589

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RDR-ERLIN1-Hu-96Tests 96 Tests
EUR 820

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RD-ERLIN1-Hu-48Tests 48 Tests
EUR 563

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RD-ERLIN1-Hu-96Tests 96 Tests
EUR 783

ERLIN1 antibody

70R-17143 50 ul
EUR 435
Description: Rabbit polyclonal ERLIN1 antibody

ERLIN1 antibody

32000-100ul 100ul
EUR 252

ERLIN1 antibody

32000-50ul 50ul
EUR 187

ERLIN1 Antibody

DF12983 200ul
EUR 304
Description: ERLIN1 Antibody detects endogenous levels of ERLIN1.

ERLIN1 antibody

70R-7393 50 ug
EUR 467
Description: Rabbit polyclonal ERLIN1 antibody raised against the N terminal of ERLIN1

ERLIN1 Antibody

1-CSB-PA007790GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ERLIN1 Antibody

1-CSB-PA007790LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ERLIN1 Polyclonal Antibody, Biotin Conjugated

A58955 100 µg
EUR 570.55
Description: Ask the seller for details

ERLIN1 Polyclonal Antibody, FITC Conjugated

A58956 100 µg
EUR 570.55
Description: The best epigenetics products

ERLIN1 Polyclonal Antibody, HRP Conjugated

A58957 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- ERLIN1 antibody

FNab02848 100µg
EUR 505.25
  • Immunogen: ER lipid raft associated 1
  • Uniprot ID: O75477
  • Gene ID: 10613
  • Research Area: Metabolism
Description: Antibody raised against ERLIN1

Anti-ERLIN1 antibody

PAab02848 100 ug
EUR 355

Anti-ERLIN1 antibody

STJ26674 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.

Anti-ERLIN1 antibody

STJ117043 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)

TG2012-2 250 ul
EUR 380

Anti-Bcl-2 Rabbit Monoclonal Antibody

M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

ERLIN1 siRNA

20-abx915644
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN1 siRNA

20-abx915645
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN1 Antibody, HRP conjugated

1-CSB-PA007790LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ERLIN1 Antibody, FITC conjugated

1-CSB-PA007790LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ERLIN1 Antibody, Biotin conjugated

1-CSB-PA007790LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-KEO4 / ERLIN1 antibody

STJ71953 100 µg
EUR 359

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348

M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human

ERLIN1 Blocking Peptide

33R-4577 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERLIN1 antibody, catalog no. 70R-7393

ERLIN1 Blocking Peptide

DF12983-BP 1mg
EUR 195

ERLIN1 cloning plasmid

CSB-CL007790HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atgactcaagcccgggttctggtggctgcagtggtggggttggtggctgtcctgctctacgcctccatccacaagattgaggagggccatctggctgtgtactacaggggaggagctttactaactagccccagtggaccaggctatcatatcatgttgcctttcattactacgt
  • Show more
Description: A cloning plasmid for the ERLIN1 gene.

ERLIN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0693103 1.0 ug DNA
EUR 154

Erlin1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6113603 1.0 ug DNA
EUR 154

Erlin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4469603 1.0 ug DNA
EUR 154

Human ERLIN1 shRNA Plasmid

20-abx957226
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ERLIN1 shRNA Plasmid

20-abx981462
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ERLIN1 Recombinant Protein (Human)

RP010903 100 ug Ask for price

ERLIN1 Recombinant Protein (Rat)

RP199907 100 ug Ask for price

ERLIN1 Recombinant Protein (Mouse)

RP132185 100 ug Ask for price

ERLIN1 Recombinant Protein (Mouse)

RP132188 100 ug Ask for price

ERLIN1 Recombinant Protein (Mouse)

RP132191 100 ug Ask for price

Anti-p53 Rabbit Monoclonal Antibody

M00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-PTEN Rabbit Monoclonal Antibody

M00006-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody

M00007-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Rb Rabbit Monoclonal Antibody

M00039-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Ras Rabbit Monoclonal Antibody

M00099-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.

Anti-ERK1 Rabbit Monoclonal Antibody

M00104-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-p21 Rabbit Monoclonal Antibody

M00145-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.

Anti-p38 Rabbit Monoclonal Antibody

M00176-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Rho Rabbit Monoclonal Antibody

M00207-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-GFAP Rabbit Monoclonal Antibody

M00213-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-MiTF Rabbit Monoclonal Antibody

M00269-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PAX6 Rabbit Monoclonal Antibody

M00273-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-MEK1 Rabbit Monoclonal Antibody

M00292-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Survivin Rabbit Monoclonal Antibody

M00379-2 100ug/vial
EUR 397
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat

Anti-Hsp27 Rabbit Monoclonal Antibody

M00676-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat.

Anti-SOX10 Rabbit Monoclonal Antibody

M00758-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PAX8 Rabbit Monoclonal Antibody

M00943-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human.

Anti-PGP9.5 Rabbit Monoclonal Antibody

M01018-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Podoplanin Rabbit Monoclonal Antibody

M01124-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.

Anti-CD74 Rabbit Monoclonal Antibody

M01340-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.

Anti-CD31 Rabbit Monoclonal Antibody

M01513-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human.

Anti-Actin Rabbit Monoclonal Antibody

M02014-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-MBP Rabbit Monoclonal Antibody

M30934-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species.

Anti-GFP Rabbit Monoclonal Antibody

M30939-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Cyclooxygenase 2 Rabbit Polyclonal Antibody

38024-100ul 100ul
EUR 252

Cyclooxygenase 2 Rabbit Polyclonal Antibody

38024-50ul 50ul
EUR 187

IGFBP-2 Polyclonal Antibody (Rabbit)

PAAI1 200 µg
EUR 299

Anti-Caspase-8 Rabbit Monoclonal Antibody

M00042-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-ER alpha Rabbit Monoclonal Antibody

M00057-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal ER alpha Antibody. Validated in ChIP, Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Human, Mouse, Rat.

Anti-Cleaved PARP Rabbit Monoclonal Antibody

M00122-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cleaved PARP Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human.

Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody

M00209-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Androgen Receptor Rabbit Monoclonal Antibody

M00542-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Androgen Receptor Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-Cyclin B1 Rabbit Monoclonal Antibody

M00745-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

Anti-Liver Arginase Rabbit Monoclonal Antibody

M01106-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Liver Arginase Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Sumo2/3 Rabbit Monoclonal Antibody

M01282-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Cytokeratin 18 Rabbit Monoclonal Antibody

M01357-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Cytokeratin 8 Rabbit Monoclonal Antibody

M01421-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 8 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse.

Anti-Cytokeratin 14 Rabbit Monoclonal Antibody

M01432-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 14 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-CD8 alpha Rabbit Monoclonal Antibody

M02236-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD8 alpha Antibody. Validated in IHC and tested in Human.

Anti-Cytokeratin 7 Rabbit Monoclonal Antibody

M02416-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Caspase-6 Rabbit Monoclonal Antibody

M02631-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-CD3 epsilon Rabbit Monoclonal Antibody

M02675-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD3 epsilon Antibody. Validated in Flow Cytometry, IP, IHC, WB and tested in Human.

Anti-Histone H4 Rabbit Monoclonal Antibody

M14495-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H4 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Histone H2A Rabbit Monoclonal Antibody

M16777-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H2A Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-EpCAM/Trop1 Rabbit Monoclonal Antibody

M30950-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal EpCAM/Trop1 Antibody. Validated in WB and tested in Human.

Anti-Cytochrome C Rabbit Monoclonal Antibody

M03529-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytochrome C Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228

M00010-2 100ul
EUR 375
Description: Anti-HER2 Rabbit Monoclonal Antibody, Clone#RM228 tested in WB, IHC, reactive to Human

Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264

M00052-2 100uL
EUR 375
Description: Anti-CD44 Rabbit Monoclonal Antibody, Clone#RM264 tested in WB, IHC, reactive to Human

Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308

M00075-2 100uL
EUR 385
Description: Anti-BRAF Rabbit Monoclonal Antibody, Clone#RM308 tested in WB, IHC, reactive to Human

Anti-cleaved Caspase-9 Rabbit Monoclonal Antibody

M00080-2 100ug/vial
EUR 397
Description: Anti-cleaved Caspase-9 Rabbit Monoclonal Antibody tested for IP, WB in Human, Mouse

Anti-CD19 Rabbit Monoclonal Antibody, Clone#RM332

M00154-2 100uL
EUR 385
Description: Anti-CD19 Rabbit Monoclonal Antibody, Clone#RM332 tested in WB, IHC, reactive to Human

Anti-CD56 Rabbit Monoclonal Antibody, Clone#RM315

M00184-2 100uL
EUR 385
Description: Anti-CD56 Rabbit Monoclonal Antibody, Clone#RM315 tested in WB, IHC, reactive to Human

Anti-MHC class I Rabbit Monoclonal Antibody

M00194-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal MHC class I Antibody. Validated in IF, WB and tested in Human.

Anti-Caspase-3 p12 Rabbit Monoclonal Antibody

M00334-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Caspase-3 p12 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-CD45 Rabbit Monoclonal Antibody, Clone#RM291

M00555-2 100uL
EUR 397
Description: Anti-CD45 Rabbit Monoclonal Antibody, Clone#RM291 tested in WB, IHC, reactive to Human

Anti-Integrin beta 1 Rabbit Monoclonal Antibody

M00772-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Integrin beta 1 Antibody. Validated in IHC, WB and tested in Human.

Anti-MyoD1 Rabbit Monoclonal Antibody, Clone#RM369

M00964-2 100uL
EUR 385
Description: Anti-MyoD1 Rabbit Monoclonal Antibody, Clone#RM369 tested in WB, IHC, reactive to Human

Anti-Hsp90 alpha + beta Rabbit Monoclonal Antibody

M01103-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Hsp90 alpha + beta Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-CD146 Rabbit Monoclonal Antibody, Clone#RM249

M01683-2 100ul
EUR 375
Description: Anti-CD146 Rabbit Monoclonal Antibody, Clone#RM249 tested in WB, IHC, reactive to Human, (Mouse, Rat)

Anti-MART1 Rabbit Monoclonal Antibody, Clone#RM333

M02033-2 100uL
EUR 385
Description: Anti-MART1 Rabbit Monoclonal Antibody, Clone#RM333 tested in WB, IHC, reactive to Human

Anti-14-3-3 Rabbit Monoclonal Antibody

M02431-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal 14-3-3 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-CD5 Rabbit Monoclonal Antibody, Clone#RM354

M02591-2 100uL
EUR 385
Description: Anti-CD5 Rabbit Monoclonal Antibody, Clone#RM354 tested in WB, IHC, reactive to Human

Anti-p53 (acetyl K382) Rabbit Monoclonal Antibody

P00001-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 (acetyl K382) Antibody. Validated in IF, IHC, ICC, WB and tested in Human.

Anti-Phospho-STAT3 (Y705) Rabbit Monoclonal Antibody

P00007-2 100ug/vial
EUR 397
Description: Anti-Phospho-STAT3 (Y705) Rabbit Monoclonal Antibody tested for IP, IF, IHC, ICC, WB in Human, Mouse, Rat

Anti-Phospho-EGFR (Y1173) Rabbit Monoclonal Antibody

P00023-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-EGFR (Y1173) Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Phospho-AKT1 (T450) Rabbit Monoclonal Antibody

P00024-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-AKT1 (T450) Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-Phospho-Tau (S396) Rabbit Monoclonal Antibody

P00097-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-Tau (S396) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Phospho-PLK1 (T210) Rabbit Monoclonal Antibody

P00182-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-PLK1 (T210) Antibody. Validated in WB and tested in Human.

Anti-Phospho-POLR2A (S5) Rabbit Monoclonal Antibody

P01029-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-POLR2A (S5) Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-CD20 Rabbit Monoclonal Antibody, Clone#RM272

M03780-2 100uL
EUR 455
Description: Anti-CD20 Rabbit Monoclonal Antibody, Clone#RM272 tested in WB, IHC, reactive to Human

Anti-CD10 Rabbit Monoclonal Antibody, Clone#RM337

M04065-2 100uL
EUR 397
Description: Anti-CD10 Rabbit Monoclonal Antibody, Clone#RM337 tested in WB, IHC, reactive to Human

Anti-Synaptophysin Rabbit Monoclonal Antibody, Clone#RM258

M05049-2 100uL
EUR 385
Description: Anti-Synaptophysin Rabbit Monoclonal Antibody, Clone#RM258 tested in WB, IHC, reactive to Human

Anti-NEFH/Nf H Rabbit Monoclonal Antibody

M05307-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal NEFH/Nf H Antibody. Validated in WB and tested in Human, Mouse, Rat.

Erlin1 ORF Vector (Rat) (pORF)

ORF066637 1.0 ug DNA
EUR 506

ERLIN1 ORF Vector (Human) (pORF)

ORF003635 1.0 ug DNA
EUR 95

Erlin1 ORF Vector (Mouse) (pORF)

ORF044063 1.0 ug DNA
EUR 506

Erlin1 ORF Vector (Mouse) (pORF)

ORF044064 1.0 ug DNA
EUR 506

Erlin1 ORF Vector (Mouse) (pORF)

ORF044065 1.0 ug DNA
EUR 506

ERLIN1 ELISA Kit (Human) (OKCD02050)

OKCD02050 96 Wells
EUR 909
Description: Description of target: Component of the ERLIN1/ERLIN2 complex which mediates the endoplasmic reticulum-associated degradation (ERAD) of inositol 1,4,5-trisphosphate receptors (IP3Rs). Involved in regulation of cellular cholesterol homeostasis by regulation the SREBP signaling pathway. Binds cholesterol and may promote ER retention of the SCAP-SREBF complex.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.107 ng/mL

Anti-Fascin 2/FSCN2 Antibody

A07840-2 100ug/vial
EUR 294

Anti-EIF4A1/2/3 Antibody

A03922-2 100ug/vial
EUR 334

Anti-ErbB 2/ERBB2 Antibody

A00010-2 100ug/vial
EUR 334

Anti-Bcl-2/BCL2 Antibody

A00040-2 100ug/vial
EUR 334

Anti-Angiopoietin-2/ANGPT2 Antibody

A00370-2 100ug/vial
EUR 334

Anti-Histone H3 (acetyl K14) Rabbit Monoclonal Antibody

P12477-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Histone H3 (acetyl K14) Antibody. Validated in IP, IF, WB and tested in Human, Rat.

Anti-Caveolin-1 Rabbit Monoclonal Antibody, Clone#RM325

M00179-2 100uL
EUR 385
Description: Anti-Caveolin-1 Rabbit Monoclonal Antibody, Clone#RM325 tested in WB, IHC, reactive to Human

Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214

M00241-2 100ug
EUR 478
Description: Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214 tested in WB, ELISA, Multiplex, ICC, reactive to All Vertebrates

Anti-Cytokeratin 5 (C-term) Rabbit Monoclonal Antibody

M00398-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 5 (C-term) Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

Anti-S100-beta Rabbit Monoclonal Antibody, Clone#RM304

M00979-2 100uL
EUR 385
Description: Anti-S100-beta Rabbit Monoclonal Antibody, Clone#RM304 tested in WB, IHC, reactive to Human

Anti-alpha smooth muscle Actin Rabbit Monoclonal Antibody

M01072-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal alpha smooth muscle Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-HLA-DRA/Hla Dr Rabbit Monoclonal Antibody

M01195-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal HLA-DRA/Hla Dr Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-TGFBI/Beta Ig H3 Rabbit Monoclonal Antibody

M01218-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal TGFBI/Beta Ig H3 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti- beta -Actin Rabbit Monoclonal Antibody, Clone#RM112

M01263-2 100uL
EUR 397
Description: Anti- beta -Actin Rabbit Monoclonal Antibody, Clone#RM112 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to All Species

Anti-Desmin (DESM) Rabbit Monoclonal Antibody, Clone#RM234

M01948-2 100ul
EUR 375
Description: Anti-Desmin (DESM) Rabbit Monoclonal Antibody, Clone#RM234 tested in WB, IHC, reactive to Human, Mouse, (Bovine, Rat)

Anti-K63-linkage Specific Ubiquitin Rabbit Monoclonal Antibody

M02848-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal K63-linkage Specific Ubiquitin Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Mouse IgG2a Rabbit Monoclonal Antibody, Clone#RM219

M30946-2 100ug
EUR 398
Description: Anti-Mouse IgG2a Rabbit Monoclonal Antibody, Clone#RM219 tested in WB (nonreduced only), IP, ICC, IHC, FC, ELISA , reactive to Mouse