Order Now: brent@sdlifesciences.com
eIF5B Polyclonal Antibody |
ES8084-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
eIF5B Polyclonal Antibody |
ES8084-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against eIF5B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
EIF5B Rabbit pAb |
A5888-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF5B Rabbit pAb |
A5888-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF5B Rabbit pAb |
A5888-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF5B Rabbit pAb |
A5888-50ul |
Abclonal |
50 ul |
EUR 223 |
EIF5B Rabbit pAb |
A15123-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF5B Rabbit pAb |
A15123-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF5B Rabbit pAb |
A15123-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF5B Rabbit pAb |
A15123-50ul |
Abclonal |
50 ul |
EUR 223 |
EIF5B antibody |
70R-17066 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EIF5B antibody |
EIF5B antibody |
38709-100ul |
SAB |
100ul |
EUR 252 |
EIF5B Antibody |
1-CSB-PA080048 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
EIF5B Antibody |
DF4055 |
Affbiotech |
200ul |
EUR 304 |
Description: EIF5B Antibody detects endogenous levels of total EIF5B. |
EIF5B antibody |
70R-35227 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal EIF5B antibody |
EIF5B antibody |
70R-50733 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal EIF5B antibody |
EIF5B Antibody |
1-CSB-PA007581GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EIF5B. Recognizes EIF5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EIF5B Conjugated Antibody |
C38709 |
SAB |
100ul |
EUR 397 |
Anti-EIF5B Antibody |
A30685 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal EIF5B Antibody. Validated in WB and tested in Human, Mouse, Rat. |
anti- EIF5B antibody |
FNab02730 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: eukaryotic translation initiation factor 5B
- Uniprot ID: O60841
- Gene ID: 9669
- Research Area: Metabolism
|
Description: Antibody raised against EIF5B |
Anti-EIF5B antibody |
STJ116285 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. |
Anti-EIF5B antibody |
STJ117317 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. |
Anti-eIF5B antibody |
STJ92886 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to eIF5B. |
EIF5B siRNA |
20-abx901692 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF5B siRNA |
20-abx915226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF5B siRNA |
20-abx915227 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-EIF5B |
YF-PA16474 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to EIF5B |
anti-EIF5B |
YF-PA25392 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to EIF5B |
EIF5B Blocking Peptide |
DF4055-BP |
Affbiotech |
1mg |
EUR 195 |
EIF5B Blocking Peptide |
20-abx063608 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF5B cloning plasmid |
CSB-CL007581HU-10ug |
Cusabio |
10ug |
EUR 1293 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3663
- Sequence: atggggaagaaacagaaaaacaagagcgaagacagcaccaaggatgacattgatcttgatgccttggctgcagaaatagaaggagctggtgctgccaaagaacaggagcctcaaaagtcaaaagggaaaaagaaaaaagagaaaaaaaagcaggactttgatgaagatgatatcc
- Show more
|
Description: A cloning plasmid for the EIF5B gene. |
Anti-EIF5B (3F9) |
YF-MA16972 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to EIF5B |
Rat EIF5B shRNA Plasmid |
20-abx989477 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EIF5B shRNA Plasmid |
20-abx956443 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EIF5B shRNA Plasmid |
20-abx981530 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
20-abx008399 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
20-abx004515 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
abx216136-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
20-abx112392 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
20-abx119110 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
20-abx328778 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 5B (EIF5B) Antibody |
abx232730-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Eif5b ORF Vector (Rat) (pORF) |
ORF066478 |
ABM |
1.0 ug DNA |
EUR 506 |
EIF5B ORF Vector (Human) (pORF) |
ORF003502 |
ABM |
1.0 ug DNA |
EUR 95 |
Eif5b ORF Vector (Mouse) (pORF) |
ORF043811 |
ABM |
1.0 ug DNA |
EUR 506 |
EIF5B sgRNA CRISPR Lentivector set (Human) |
K0672201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eif5b sgRNA CRISPR Lentivector set (Rat) |
K7336901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eif5b sgRNA CRISPR Lentivector set (Mouse) |
K4811301 |
ABM |
3 x 1.0 ug |
EUR 339 |
EIF5B sgRNA CRISPR Lentivector (Human) (Target 1) |
K0672202 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF5B sgRNA CRISPR Lentivector (Human) (Target 2) |
K0672203 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF5B sgRNA CRISPR Lentivector (Human) (Target 3) |
K0672204 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif5b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7336902 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif5b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7336903 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif5b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7336904 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4811302 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4811303 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif5b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4811304 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF5B Protein Vector (Mouse) (pPB-C-His) |
PV175242 |
ABM |
500 ng |
EUR 1065 |
EIF5B Protein Vector (Mouse) (pPB-N-His) |
PV175243 |
ABM |
500 ng |
EUR 1065 |
EIF5B Protein Vector (Mouse) (pPM-C-HA) |
PV175244 |
ABM |
500 ng |
EUR 1065 |
EIF5B Protein Vector (Mouse) (pPM-C-His) |
PV175245 |
ABM |
500 ng |
EUR 1065 |
EIF5B Protein Vector (Rat) (pPB-C-His) |
PV265910 |
ABM |
500 ng |
EUR 1191 |
EIF5B Protein Vector (Rat) (pPB-N-His) |
PV265911 |
ABM |
500 ng |
EUR 1191 |
EIF5B Protein Vector (Rat) (pPM-C-HA) |
PV265912 |
ABM |
500 ng |
EUR 1191 |
EIF5B Protein Vector (Rat) (pPM-C-His) |
PV265913 |
ABM |
500 ng |
EUR 1191 |
EIF5B Protein Vector (Human) (pPB-C-His) |
PV014005 |
ABM |
500 ng |
EUR 329 |
EIF5B Protein Vector (Human) (pPB-N-His) |
PV014006 |
ABM |
500 ng |
EUR 329 |
EIF5B Protein Vector (Human) (pPM-C-HA) |
PV014007 |
ABM |
500 ng |
EUR 329 |
EIF5B Protein Vector (Human) (pPM-C-His) |
PV014008 |
ABM |
500 ng |
EUR 329 |
Eif5b 3'UTR GFP Stable Cell Line |
TU155745 |
ABM |
1.0 ml |
Ask for price |
Eif5b 3'UTR Luciferase Stable Cell Line |
TU105745 |
ABM |
1.0 ml |
Ask for price |
Eif5b 3'UTR Luciferase Stable Cell Line |
TU203912 |
ABM |
1.0 ml |
Ask for price |
Eif5b 3'UTR GFP Stable Cell Line |
TU253912 |
ABM |
1.0 ml |
Ask for price |
EIF5B 3'UTR GFP Stable Cell Line |
TU056803 |
ABM |
1.0 ml |
EUR 1394 |
EIF5B 3'UTR Luciferase Stable Cell Line |
TU006803 |
ABM |
1.0 ml |
EUR 1394 |
EIF5B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV686233 |
ABM |
1.0 ug DNA |
EUR 1355 |
EIF5B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV686237 |
ABM |
1.0 ug DNA |
EUR 1355 |
EIF5B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV686238 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |