Order Now: brent@sdlifesciences.com
DZIP3 Polyclonal Antibody |
ABP57084-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730
- Applications tips:
|
Description: A polyclonal antibody for detection of DZIP3 from Human. This DZIP3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730 |
DZIP3 Polyclonal Antibody |
ABP57084-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730
- Applications tips:
|
Description: A polyclonal antibody for detection of DZIP3 from Human. This DZIP3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730 |
DZIP3 Polyclonal Antibody |
ABP57084-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730
- Applications tips:
|
Description: A polyclonal antibody for detection of DZIP3 from Human. This DZIP3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human DZIP3 at AA range: 650-730 |
DZIP3 Rabbit pAb |
A7179-100ul |
Abclonal |
100 ul |
EUR 308 |
DZIP3 Rabbit pAb |
A7179-200ul |
Abclonal |
200 ul |
EUR 459 |
DZIP3 Rabbit pAb |
A7179-20ul |
Abclonal |
20 ul |
EUR 183 |
DZIP3 Rabbit pAb |
A7179-50ul |
Abclonal |
50 ul |
EUR 223 |
DZIP3 antibody |
70R-35104 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Rabbit polyclonal DZIP3 antibody |
DZIP3 Antibody |
47820-100ul |
SAB |
100ul |
EUR 252 |
DZIP3 Antibody |
DF4017 |
Affbiotech |
200ul |
EUR 304 |
Description: DZIP3 Antibody detects endogenous levels of total DZIP3. |
DZIP3 Antibody |
1-CSB-PA080047 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DZIP3. Recognizes DZIP3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
DZIP3 Conjugated Antibody |
C47820 |
SAB |
100ul |
EUR 397 |
Anti-DZIP3 antibody |
STJ92805 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to DZIP3. |
DZIP3 siRNA |
20-abx914847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DZIP3 siRNA |
20-abx914848 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DZIP3 |
YF-PA25391 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to DZIP3 |
DZIP3 Blocking Peptide |
20-abx061191 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DZIP3 Blocking Peptide |
DF4017-BP |
Affbiotech |
1mg |
EUR 195 |
DZIP3 cloning plasmid |
CSB-CL771469HU-10ug |
Cusabio |
10ug |
EUR 1281 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3627
- Sequence: atggattctctaccagatgaattttttgtgaggcatcctgctgtggaggatcagaggaaggaagaaactgagaataagctagaaaaatcatctggtcaactgaacaaacaggaaaatgacatacctactgatcttgtccctgttaacctactattagaagtgaagaagttattaa
- Show more
|
Description: A cloning plasmid for the DZIP3 gene. |
Anti-DZIP3 (3A1) |
YF-MA16970 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DZIP3 |
Mouse E3 ubiquitin- protein ligase DZIP3, Dzip3 ELISA KIT |
ELI-26572m |
Lifescience Market |
96 Tests |
EUR 865 |
Human E3 ubiquitin- protein ligase DZIP3, DZIP3 ELISA KIT |
ELI-09249h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse DZIP3 shRNA Plasmid |
20-abx981329 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DZIP3 shRNA Plasmid |
20-abx956440 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DZIP3 ORF Vector (Human) (pORF) |
ORF003356 |
ABM |
1.0 ug DNA |
EUR 95 |
Dzip3 ORF Vector (Mouse) (pORF) |
ORF043502 |
ABM |
1.0 ug DNA |
EUR 506 |
Dzip3 ORF Vector (Mouse) (pORF) |
ORF043503 |
ABM |
1.0 ug DNA |
EUR 506 |
DAZ Interacting Zinc Finger Protein 3 (DZIP3) Antibody |
20-abx133609 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
DAZ Interacting Zinc Finger Protein 3 (DZIP3) Antibody |
20-abx006436 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
DAZ Interacting Zinc Finger Protein 3 (DZIP3) Antibody |
20-abx324656 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DZIP3 sgRNA CRISPR Lentivector set (Human) |
K0647801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dzip3 sgRNA CRISPR Lentivector set (Mouse) |
K4754001 |
ABM |
3 x 1.0 ug |
EUR 339 |
DZIP3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0647802 |
ABM |
1.0 ug DNA |
EUR 154 |
DZIP3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0647803 |
ABM |
1.0 ug DNA |
EUR 154 |
DZIP3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0647804 |
ABM |
1.0 ug DNA |
EUR 154 |
Dzip3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4754002 |
ABM |
1.0 ug DNA |
EUR 154 |
Dzip3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4754003 |
ABM |
1.0 ug DNA |
EUR 154 |
Dzip3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4754004 |
ABM |
1.0 ug DNA |
EUR 154 |
DZIP3 Protein Vector (Mouse) (pPB-C-His) |
PV174006 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPB-N-His) |
PV174007 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPM-C-HA) |
PV174008 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPM-C-His) |
PV174009 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPB-C-His) |
PV174010 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPB-N-His) |
PV174011 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPM-C-HA) |
PV174012 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Mouse) (pPM-C-His) |
PV174013 |
ABM |
500 ng |
EUR 1065 |
DZIP3 Protein Vector (Human) (pPB-C-His) |
PV013421 |
ABM |
500 ng |
EUR 329 |
DZIP3 Protein Vector (Human) (pPB-N-His) |
PV013422 |
ABM |
500 ng |
EUR 329 |
DZIP3 Protein Vector (Human) (pPM-C-HA) |
PV013423 |
ABM |
500 ng |
EUR 329 |
DZIP3 Protein Vector (Human) (pPM-C-His) |
PV013424 |
ABM |
500 ng |
EUR 329 |
Dzip3 3'UTR GFP Stable Cell Line |
TU155507 |
ABM |
1.0 ml |
Ask for price |
DZIP3 3'UTR Luciferase Stable Cell Line |
TU006498 |
ABM |
1.0 ml |
EUR 2333 |
Dzip3 3'UTR Luciferase Stable Cell Line |
TU105507 |
ABM |
1.0 ml |
Ask for price |
DZIP3 3'UTR GFP Stable Cell Line |
TU056498 |
ABM |
1.0 ml |
EUR 2333 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |