DUSP6 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

DUSP6 Polyclonal Antibody
ABP57351-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody
ABP57351-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody
ABP57351-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

DUSP6 Polyclonal Antibody
ES8344-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

DUSP6 Polyclonal Antibody
ES8344-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
DLR-DUSP6-Hu-48T 48T
EUR 517
  • Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
DLR-DUSP6-Hu-96T 96T
EUR 673
  • Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RDR-DUSP6-Hu-48Tests 48 Tests
EUR 544

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RDR-DUSP6-Hu-96Tests 96 Tests
EUR 756

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RD-DUSP6-Hu-48Tests 48 Tests
EUR 521

Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit
RD-DUSP6-Hu-96Tests 96 Tests
EUR 723

DUSP6 Rabbit pAb
A0637-100ul 100 ul
EUR 308

DUSP6 Rabbit pAb
A0637-200ul 200 ul
EUR 459

DUSP6 Rabbit pAb
A0637-20ul 20 ul Ask for price

DUSP6 Rabbit pAb
A0637-50ul 50 ul Ask for price

DUSP6 Rabbit mAb
A0133-100ul 100 ul
EUR 410

DUSP6 Rabbit mAb
A0133-200ul 200 ul
EUR 571

DUSP6 Rabbit mAb
A0133-20ul 20 ul
EUR 221

DUSP6 Rabbit mAb
A0133-50ul 50 ul
EUR 287

DUSP6 Rabbit pAb
A3171-100ul 100 ul
EUR 308

DUSP6 Rabbit pAb
A3171-200ul 200 ul
EUR 459

DUSP6 Rabbit pAb
A3171-20ul 20 ul
EUR 183

DUSP6 Rabbit pAb
A3171-50ul 50 ul
EUR 223

Polyclonal DUSP6 Antibody (Center)
AMM05849G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DUSP6 (Center). This antibody is tested and proven to work in the following applications:

DUSP6 Antibody
31069-100ul 100ul
EUR 252

DUSP6 Antibody
31069-50ul 50ul
EUR 187

DUSP6 antibody
70R-16958 50 ul
EUR 435
Description: Rabbit polyclonal DUSP6 antibody

DUSP6 antibody
70R-13417 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DUSP6 antibody

DUSP6 antibody
70R-31932 100 ug
EUR 327
Description: Rabbit polyclonal DUSP6 antibody

DUSP6 Antibody
33916-100ul 100ul
EUR 252

DUSP6 Antibody
33916-50ul 50ul
EUR 187

DUSP6 antibody
38204-100ul 100ul
EUR 252

DUSP6 antibody
38613-100ul 100ul
EUR 252

DUSP6 Antibody
48635-100ul 100ul
EUR 333

DUSP6 Antibody
48635-50ul 50ul
EUR 239

DUSP6 Antibody
1-CSB-PA621973LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

DUSP6 Antibody
1-CSB-PA625538
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

DUSP6 Antibody
DF2919 200ul
EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody
DF6284 200ul
EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody
DF7228 200ul
EUR 304
Description: DUSP6 Antibody detects endogenous levels of total DUSP6.

DUSP6 Antibody
1-CSB-PA251438
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

DUSP6 Antibody
1-CSB-PA274273
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:1000-3000

DUSP6 Antibody
CSB-PA230795-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

DUSP6 Antibody
CSB-PA230795-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

DUSP6 Antibody
1-CSB-PA007259GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DUSP6 Antibody
1-CSB-PA007843
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

DUSP6 Antibody
ABD2919 100 ug
EUR 438

DUSP6 Antibody
ABD6284 100 ug
EUR 438

DUSP6 Antibody
ABD7228 100 ug
EUR 438

Polyclonal DUSP6 / MKP3 Antibody (C-Term)
APR11807G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DUSP6 / MKP3 (C-Term). This antibody is tested and proven to work in the following applications:

DUSP6 Conjugated Antibody
C48635 100ul
EUR 397

DUSP6 Conjugated Antibody
C31069 100ul
EUR 397

DUSP6 Conjugated Antibody
C38204 100ul
EUR 397

Anti-DUSP6 antibody
PAab02569 100 ug
EUR 355

Anti-DUSP6 antibody
STJ111007 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene.

Anti-DUSP6 antibody
STJ23447 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene.

Anti-DUSP6 antibody
STJ97598 200 µl
EUR 197
Description: Rabbit polyclonal to DUSP6.

Anti-DUSP6/Mkp 3 Rabbit Monoclonal Antibody
M02157 100ug/vial
EUR 397
Description: Rabbit Monoclonal DUSP6/Mkp 3 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Dusp6/ Rat Dusp6 ELISA Kit
ELI-47163r 96 Tests
EUR 886

Rabbit Anti-DUSP6 monoclonal antibody, clone TS40-10
CABT-L577 100 ul
EUR 777

DUSP6 siRNA
20-abx901606
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DUSP6 siRNA
20-abx914762
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DUSP6 siRNA
20-abx914763
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- DUSP6
PVT10010 2 ug
EUR 266

pDsRed2- Dusp6
PVT10260 2 ug
EUR 301

anti-DUSP6
YF-PA11443 50 ug
EUR 363
Description: Mouse polyclonal to DUSP6

anti-DUSP6
YF-PA11444 100 ug
EUR 403
Description: Rabbit polyclonal to DUSP6

DUSP6 Antibody, HRP conjugated
1-CSB-PA621973LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DUSP6 Antibody, FITC conjugated
1-CSB-PA621973LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DUSP6 Antibody, Biotin conjugated
1-CSB-PA621973LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human DUSP6
SPC-1126D 0.1ml
EUR 354
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated.

Antibody for Human DUSP6
SPC-1126D-A390 0.1ml
EUR 401
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390.

Antibody for Human DUSP6
SPC-1126D-A488 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488.

Antibody for Human DUSP6
SPC-1126D-A565 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565.

Antibody for Human DUSP6
SPC-1126D-A594 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594.

Antibody for Human DUSP6
SPC-1126D-A633 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633.

Antibody for Human DUSP6
SPC-1126D-A655 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655.

Antibody for Human DUSP6
SPC-1126D-A680 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680.

Antibody for Human DUSP6
SPC-1126D-A700 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700.

Antibody for Human DUSP6
SPC-1126D-ALP 0.1ml
EUR 394
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human DUSP6
SPC-1126D-APC 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC .

Antibody for Human DUSP6
SPC-1126D-APCCY7 0.1ml
EUR 471
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7.

Antibody for Human DUSP6
SPC-1126D-BI 0.1ml
EUR 396
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin.

Antibody for Human DUSP6
SPC-1126D-DY350 0.1ml
EUR 475
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350.

Antibody for Human DUSP6
SPC-1126D-DY405 0.1ml
EUR 452
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405.

Antibody for Human DUSP6
SPC-1126D-DY488 0.1ml
EUR 432
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488.

Antibody for Human DUSP6
SPC-1126D-DY594 0.1ml
EUR 436
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594.

Antibody for Human DUSP6
SPC-1126D-DY633 0.1ml
EUR 426
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633.

Antibody for Human DUSP6
SPC-1126D-FITC 0.1ml
EUR 392
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC.

Antibody for Human DUSP6
SPC-1126D-HRP 0.1ml
EUR 388
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP.

Antibody for Human DUSP6
SPC-1126D-P594 0.1ml
EUR 407
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594.

Antibody for Human DUSP6
SPC-1126D-PCP 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP.

Antibody for Human DUSP6
SPC-1126D-RPE 0.1ml
EUR 397
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE .

Antibody for Human DUSP6
SPC-1126D-STR 0.1ml
EUR 398
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin.

Antibody for Human DUSP6
SPC-1127D 0.1ml
EUR 354
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated.

Antibody for Human DUSP6
SPC-1127D-A390 0.1ml
EUR 401
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390.

Antibody for Human DUSP6
SPC-1127D-A488 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488.

Antibody for Human DUSP6
SPC-1127D-A565 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565.

Antibody for Human DUSP6
SPC-1127D-A594 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594.

Antibody for Human DUSP6
SPC-1127D-A633 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633.

Antibody for Human DUSP6
SPC-1127D-A655 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655.

Antibody for Human DUSP6
SPC-1127D-A680 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680.

Antibody for Human DUSP6
SPC-1127D-A700 0.1ml
EUR 400
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700.

Antibody for Human DUSP6
SPC-1127D-ALP 0.1ml
EUR 394
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human DUSP6
SPC-1127D-APC 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC .

Antibody for Human DUSP6
SPC-1127D-APCCY7 0.1ml
EUR 471
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7.

Antibody for Human DUSP6
SPC-1127D-BI 0.1ml
EUR 396
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin.

Antibody for Human DUSP6
SPC-1127D-DY350 0.1ml
EUR 475
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350.

Antibody for Human DUSP6
SPC-1127D-DY405 0.1ml
EUR 452
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405.

Antibody for Human DUSP6
SPC-1127D-DY488 0.1ml
EUR 432
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488.

Antibody for Human DUSP6
SPC-1127D-DY594 0.1ml
EUR 436
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594.

Antibody for Human DUSP6
SPC-1127D-DY633 0.1ml
EUR 426
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633.

Antibody for Human DUSP6
SPC-1127D-FITC 0.1ml
EUR 392
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC.

Antibody for Human DUSP6
SPC-1127D-HRP 0.1ml
EUR 388
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP.

Antibody for Human DUSP6
SPC-1127D-P594 0.1ml
EUR 407
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594.

Antibody for Human DUSP6
SPC-1127D-PCP 0.1ml
EUR 399
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP.

Antibody for Human DUSP6
SPC-1127D-RPE 0.1ml
EUR 397
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE .

Antibody for Human DUSP6
SPC-1127D-STR 0.1ml
EUR 398
  • DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin.

Anti-DUSP6 / MKP3 antibody
STJ72927 100 µg
EUR 359

DUSP6 Blocking Peptide
DF2919-BP 1mg
EUR 195

DUSP6 Blocking Peptide
DF6284-BP 1mg
EUR 195

DUSP6 Blocking Peptide
DF7228-BP 1mg
EUR 195

DUSP6 Blocking Peptide
20-abx161601
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DUSP6 cloning plasmid
CSB-CL621973HU1-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc
  • Show more
Description: A cloning plasmid for the DUSP6 gene.

DUSP6 cloning plasmid
CSB-CL621973HU2-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc
  • Show more
Description: A cloning plasmid for the DUSP6 gene.

anti-DUSP6 (3G2)
LF-MA10089 100 ug
EUR 363
Description: Mouse monoclonal to DUSP6

pT7- His- Dusp6
PVT10145 2 ug
EUR 301

Anti-DUSP6 (3G2)
YF-MA12752 200 ul
EUR 363
Description: Mouse monoclonal to DUSP6

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse)
4-PAF976Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6)

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), APC
4-PAF976Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with APC.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAF976Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Biotin.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Cy3
4-PAF976Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Cy3.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), FITC
4-PAF976Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with FITC.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), HRP
4-PAF976Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with HRP.

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), PE
4-PAF976Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with PE.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx214579
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx214744
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx112182
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx123735
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx125328
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx036164-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx129251
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx134468
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx121891
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx172168
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx013641
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx033959-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx033959-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx329432
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx331509-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx326976
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx334002
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx430448-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
abx232569-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody
20-abx002274
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DUSP6 protein (His tag)
80R-3907 20 ug
EUR 327
Description: Purified recombinant DUSP6 protein (His tag)

DUSP6 ELISA KIT|Human
EF009246 96 Tests
EUR 689

Mouse DUSP6 shRNA Plasmid
20-abx976229
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DUSP6 shRNA Plasmid
20-abx987322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DUSP6 shRNA Plasmid
20-abx951296
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DUSP6 Recombinant Protein (Human)
RP009976 100 ug Ask for price

DUSP6 Recombinant Protein (Human)
RP009979 100 ug Ask for price

DUSP6 Recombinant Protein (Rat)
RP198839 100 ug Ask for price

DUSP6 Recombinant Protein (Mouse)
RP130325 100 ug Ask for price

Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAF976Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DUSP6 (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with APC-Cy7.

Monoclonal DUSP6 Antibody (monoclonal) (M01), Clone: 3G2
APG03249G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DUSP6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3G2. This antibody is applicable in WB, IHC and IF, E

Dual Specificity Phosphatase 6 (DUSP6) Antibody (HRP)
20-abx335466
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody (FITC)
20-abx335467
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dual Specificity Phosphatase 6 (DUSP6) Antibody (Biotin)
20-abx335468
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dusp6 ORF Vector (Rat) (pORF)
ORF066281 1.0 ug DNA
EUR 506

h DUSP6 inducible lentiviral particles
LVP206 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DUSP6, is fully sequence verified and matched to NCBI accession ID: NM_001946

DUSP6 ORF Vector (Human) (pORF)
ORF003326 1.0 ug DNA
EUR 95

DUSP6 ORF Vector (Human) (pORF)
ORF003327 1.0 ug DNA
EUR 95

Dusp6 ORF Vector (Mouse) (pORF)
ORF043443 1.0 ug DNA
EUR 506

DUSP6 ELISA Kit (Human) (OKCD00989)
OKCD00989 96 Wells
EUR 831
Description: Description of target: Inactivates MAP kinases. Has a specificity for the ERK family (PubMed:9858808). Plays an important role in alleviating chronic postoperative pain. Necessary for the normal dephosphorylation of the long-lasting phosphorylated forms of spinal MAPK1/3 and MAP kinase p38 induced by peripheral surgery, which drives the resolution of acute postoperative allodynia (By similarity).By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:Q9DBB1 (DUS6_MOUSE)1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Differential regulation of the MAP, SAP and RK/p38 kinases by Pyst1, a novel cytosolic dual-specificity phosphatase."_x005F_x005F_x000D_Groom L.A., Sneddon A.A., Alessi D.R., Dowd S., Keyse S.M._x005F_x005F_x000D_EMBO J. 15:3621-3632(1996) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, SUBCELLULAR LOCATION, VARIANT LEU-114. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.126 ng/mL

Monoclonal MKP3 / DUSP6 Antibody (clone 3G2), Clone: 3G2
AMM06405G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human MKP3 / DUSP6 (clone 3G2). The antibodies are raised in Mouse and are from clone 3G2. This antibody is applicable in WB and IHC-P, IF, E, RNAi

DUSP6 sgRNA CRISPR Lentivector set (Human)
K0638401 3 x 1.0 ug
EUR 339

Dusp6 sgRNA CRISPR Lentivector set (Mouse)
K5035001 3 x 1.0 ug
EUR 339

Dusp6 sgRNA CRISPR Lentivector set (Rat)
K6936601 3 x 1.0 ug
EUR 339

Recombinant Dual Specificity Phosphatase 6 (DUSP6)
4-RPF976Hu01
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16828
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dual Specificity Phosphatase 6 expressed in: E.coli