Order Now: brent@sdlifesciences.com
DUSP6 Polyclonal Antibody |
ABP57351-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
DUSP6 Polyclonal Antibody |
ABP57351-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
DUSP6 Polyclonal Antibody |
ABP57351-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of DUSP6 from Human, Mouse, Rat. This DUSP6 antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
DUSP6 Polyclonal Antibody |
ES8344-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA |
DUSP6 Polyclonal Antibody |
ES8344-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DUSP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA |
Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit |
DLR-DUSP6-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit |
DLR-DUSP6-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dual Specificity Phosphatase 6 (DUSP6) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit |
RDR-DUSP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit |
RDR-DUSP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit |
RD-DUSP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dual Specificity Phosphatase 6 (DUSP6) ELISA Kit |
RD-DUSP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
DUSP6 Rabbit pAb |
A0637-100ul |
Abclonal |
100 ul |
EUR 308 |
DUSP6 Rabbit pAb |
A0637-200ul |
Abclonal |
200 ul |
EUR 459 |
DUSP6 Rabbit pAb |
A0637-20ul |
Abclonal |
20 ul |
Ask for price |
DUSP6 Rabbit pAb |
A0637-50ul |
Abclonal |
50 ul |
Ask for price |
DUSP6 Rabbit mAb |
A0133-100ul |
Abclonal |
100 ul |
EUR 410 |
DUSP6 Rabbit mAb |
A0133-200ul |
Abclonal |
200 ul |
EUR 571 |
DUSP6 Rabbit mAb |
A0133-20ul |
Abclonal |
20 ul |
EUR 221 |
DUSP6 Rabbit mAb |
A0133-50ul |
Abclonal |
50 ul |
EUR 287 |
DUSP6 Rabbit pAb |
A3171-100ul |
Abclonal |
100 ul |
EUR 308 |
DUSP6 Rabbit pAb |
A3171-200ul |
Abclonal |
200 ul |
EUR 459 |
DUSP6 Rabbit pAb |
A3171-20ul |
Abclonal |
20 ul |
EUR 183 |
DUSP6 Rabbit pAb |
A3171-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal DUSP6 Antibody (Center) |
AMM05849G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DUSP6 (Center). This antibody is tested and proven to work in the following applications: |
DUSP6 Antibody |
31069-100ul |
SAB |
100ul |
EUR 252 |
DUSP6 Antibody |
31069-50ul |
SAB |
50ul |
EUR 187 |
DUSP6 antibody |
70R-16958 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DUSP6 antibody |
DUSP6 antibody |
70R-13417 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal DUSP6 antibody |
DUSP6 antibody |
70R-31932 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal DUSP6 antibody |
DUSP6 Antibody |
33916-100ul |
SAB |
100ul |
EUR 252 |
DUSP6 Antibody |
33916-50ul |
SAB |
50ul |
EUR 187 |
DUSP6 antibody |
38204-100ul |
SAB |
100ul |
EUR 252 |
DUSP6 antibody |
38613-100ul |
SAB |
100ul |
EUR 252 |
DUSP6 Antibody |
48635-100ul |
SAB |
100ul |
EUR 333 |
DUSP6 Antibody |
48635-50ul |
SAB |
50ul |
EUR 239 |
DUSP6 Antibody |
1-CSB-PA621973LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
DUSP6 Antibody |
1-CSB-PA625538 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
DUSP6 Antibody |
DF2919 |
Affbiotech |
200ul |
EUR 304 |
Description: DUSP6 Antibody detects endogenous levels of total DUSP6. |
DUSP6 Antibody |
DF6284 |
Affbiotech |
200ul |
EUR 304 |
Description: DUSP6 Antibody detects endogenous levels of total DUSP6. |
DUSP6 Antibody |
DF7228 |
Affbiotech |
200ul |
EUR 304 |
Description: DUSP6 Antibody detects endogenous levels of total DUSP6. |
DUSP6 Antibody |
1-CSB-PA251438 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
DUSP6 Antibody |
1-CSB-PA274273 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:1000-3000 |
DUSP6 Antibody |
CSB-PA230795- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
DUSP6 Antibody |
CSB-PA230795-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
DUSP6 Antibody |
1-CSB-PA007259GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DUSP6 Antibody |
1-CSB-PA007843 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
Polyclonal DUSP6 / MKP3 Antibody (C-Term) |
APR11807G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DUSP6 / MKP3 (C-Term). This antibody is tested and proven to work in the following applications: |
DUSP6 Conjugated Antibody |
C48635 |
SAB |
100ul |
EUR 397 |
DUSP6 Conjugated Antibody |
C31069 |
SAB |
100ul |
EUR 397 |
DUSP6 Conjugated Antibody |
C38204 |
SAB |
100ul |
EUR 397 |
Anti-DUSP6 antibody |
STJ111007 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. |
Anti-DUSP6 antibody |
STJ23447 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. |
Anti-DUSP6 antibody |
STJ97598 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to DUSP6. |
Anti-DUSP6/Mkp 3 Rabbit Monoclonal Antibody |
M02157 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal DUSP6/Mkp 3 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat. |
DUSP6 siRNA |
20-abx901606 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DUSP6 siRNA |
20-abx914762 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DUSP6 siRNA |
20-abx914763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DUSP6 |
YF-PA11443 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DUSP6 |
anti-DUSP6 |
YF-PA11444 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to DUSP6 |
DUSP6 Antibody, HRP conjugated |
1-CSB-PA621973LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DUSP6 Antibody, FITC conjugated |
1-CSB-PA621973LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DUSP6 Antibody, Biotin conjugated |
1-CSB-PA621973LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP6. Recognizes DUSP6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Antibody for Human DUSP6 |
SPC-1126D |
Stressmarq |
0.1ml |
EUR 354 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated. |
Antibody for Human DUSP6 |
SPC-1126D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390. |
Antibody for Human DUSP6 |
SPC-1126D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488. |
Antibody for Human DUSP6 |
SPC-1126D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565. |
Antibody for Human DUSP6 |
SPC-1126D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594. |
Antibody for Human DUSP6 |
SPC-1126D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633. |
Antibody for Human DUSP6 |
SPC-1126D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655. |
Antibody for Human DUSP6 |
SPC-1126D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680. |
Antibody for Human DUSP6 |
SPC-1126D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700. |
Antibody for Human DUSP6 |
SPC-1126D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human DUSP6 |
SPC-1126D-APC |
Stressmarq |
0.1ml |
EUR 399 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC . |
Antibody for Human DUSP6 |
SPC-1126D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7. |
Antibody for Human DUSP6 |
SPC-1126D-BI |
Stressmarq |
0.1ml |
EUR 396 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin. |
Antibody for Human DUSP6 |
SPC-1126D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350. |
Antibody for Human DUSP6 |
SPC-1126D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405. |
Antibody for Human DUSP6 |
SPC-1126D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488. |
Antibody for Human DUSP6 |
SPC-1126D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594. |
Antibody for Human DUSP6 |
SPC-1126D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633. |
Antibody for Human DUSP6 |
SPC-1126D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC. |
Antibody for Human DUSP6 |
SPC-1126D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP. |
Antibody for Human DUSP6 |
SPC-1126D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594. |
Antibody for Human DUSP6 |
SPC-1126D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP. |
Antibody for Human DUSP6 |
SPC-1126D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE . |
Antibody for Human DUSP6 |
SPC-1126D-STR |
Stressmarq |
0.1ml |
EUR 398 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide corresponding to the N-terminal of human DUSP6 (AA 3-16). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin. |
Antibody for Human DUSP6 |
SPC-1127D |
Stressmarq |
0.1ml |
EUR 354 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is unconjugated. |
Antibody for Human DUSP6 |
SPC-1127D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 390. |
Antibody for Human DUSP6 |
SPC-1127D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 488. |
Antibody for Human DUSP6 |
SPC-1127D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 565. |
Antibody for Human DUSP6 |
SPC-1127D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 594. |
Antibody for Human DUSP6 |
SPC-1127D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 633. |
Antibody for Human DUSP6 |
SPC-1127D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 655. |
Antibody for Human DUSP6 |
SPC-1127D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 680. |
Antibody for Human DUSP6 |
SPC-1127D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to ATTO 700. |
Antibody for Human DUSP6 |
SPC-1127D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human DUSP6 |
SPC-1127D-APC |
Stressmarq |
0.1ml |
EUR 399 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC . |
Antibody for Human DUSP6 |
SPC-1127D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to APC/Cy7. |
Antibody for Human DUSP6 |
SPC-1127D-BI |
Stressmarq |
0.1ml |
EUR 396 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Biotin. |
Antibody for Human DUSP6 |
SPC-1127D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 350. |
Antibody for Human DUSP6 |
SPC-1127D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 405. |
Antibody for Human DUSP6 |
SPC-1127D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 488. |
Antibody for Human DUSP6 |
SPC-1127D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 594. |
Antibody for Human DUSP6 |
SPC-1127D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Dylight 633. |
Antibody for Human DUSP6 |
SPC-1127D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to FITC. |
Antibody for Human DUSP6 |
SPC-1127D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to HRP. |
Antibody for Human DUSP6 |
SPC-1127D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PE/ATTO 594. |
Antibody for Human DUSP6 |
SPC-1127D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to PerCP. |
Antibody for Human DUSP6 |
SPC-1127D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to RPE . |
Antibody for Human DUSP6 |
SPC-1127D-STR |
Stressmarq |
0.1ml |
EUR 398 |
- DUSP6 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP6 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP6 (AA 76-90). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP6 antibody is conjugated to Streptavidin. |
DUSP6 Blocking Peptide |
DF2919-BP |
Affbiotech |
1mg |
EUR 195 |
DUSP6 Blocking Peptide |
DF6284-BP |
Affbiotech |
1mg |
EUR 195 |
DUSP6 Blocking Peptide |
DF7228-BP |
Affbiotech |
1mg |
EUR 195 |
DUSP6 Blocking Peptide |
20-abx161601 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DUSP6 cloning plasmid |
CSB-CL621973HU1-10ug |
Cusabio |
10ug |
EUR 430 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1146
- Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc
- Show more
|
Description: A cloning plasmid for the DUSP6 gene. |
DUSP6 cloning plasmid |
CSB-CL621973HU2-10ug |
Cusabio |
10ug |
EUR 430 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1146
- Sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcc
- Show more
|
Description: A cloning plasmid for the DUSP6 gene. |
anti-DUSP6 (3G2) |
LF-MA10089 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DUSP6 |
Anti-DUSP6 (3G2) |
YF-MA12752 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to DUSP6 |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse) |
4-PAF976Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6) |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), APC |
4-PAF976Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with APC. |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAF976Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Biotin. |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAF976Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with Cy3. |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), FITC |
4-PAF976Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with FITC. |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), HRP |
4-PAF976Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with HRP. |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), PE |
4-PAF976Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with PE. |
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx214579 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx214744 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx112182 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx123735 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx125328 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
abx036164-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx129251 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx134468 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx121891 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx172168 |
Abbexa |
|
|
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx013641 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
abx033959-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
abx033959-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx329432 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
abx331509-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx326976 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx334002 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
abx430448-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
abx232569-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody |
20-abx002274 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
DUSP6 protein (His tag) |
80R-3907 |
Fitzgerald |
20 ug |
EUR 327 |
Description: Purified recombinant DUSP6 protein (His tag) |
Mouse DUSP6 shRNA Plasmid |
20-abx976229 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat DUSP6 shRNA Plasmid |
20-abx987322 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DUSP6 shRNA Plasmid |
20-abx951296 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DUSP6 Recombinant Protein (Human) |
RP009976 |
ABM |
100 ug |
Ask for price |
DUSP6 Recombinant Protein (Human) |
RP009979 |
ABM |
100 ug |
Ask for price |
DUSP6 Recombinant Protein (Rat) |
RP198839 |
ABM |
100 ug |
Ask for price |
DUSP6 Recombinant Protein (Mouse) |
RP130325 |
ABM |
100 ug |
Ask for price |
Dual Specificity Phosphatase 6 (DUSP6) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAF976Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DUSP6 (Met1~Ser300)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Dual Specificity Phosphatase 6 (DUSP6). This antibody is labeled with APC-Cy7. |
Monoclonal DUSP6 Antibody (monoclonal) (M01), Clone: 3G2 |
APG03249G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human DUSP6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3G2. This antibody is applicable in WB, IHC and IF, E |
Dual Specificity Phosphatase 6 (DUSP6) Antibody (HRP) |
20-abx335466 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody (FITC) |
20-abx335467 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 6 (DUSP6) Antibody (Biotin) |
20-abx335468 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dusp6 ORF Vector (Rat) (pORF) |
ORF066281 |
ABM |
1.0 ug DNA |
EUR 506 |
h DUSP6 inducible lentiviral particles |
LVP206 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DUSP6, is fully sequence verified and matched to NCBI accession ID: NM_001946 |
DUSP6 ORF Vector (Human) (pORF) |
ORF003326 |
ABM |
1.0 ug DNA |
EUR 95 |
DUSP6 ORF Vector (Human) (pORF) |
ORF003327 |
ABM |
1.0 ug DNA |
EUR 95 |
Dusp6 ORF Vector (Mouse) (pORF) |
ORF043443 |
ABM |
1.0 ug DNA |
EUR 506 |
DUSP6 ELISA Kit (Human) (OKCD00989) |
OKCD00989 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Inactivates MAP kinases. Has a specificity for the ERK family (PubMed:9858808). Plays an important role in alleviating chronic postoperative pain. Necessary for the normal dephosphorylation of the long-lasting phosphorylated forms of spinal MAPK1/3 and MAP kinase p38 induced by peripheral surgery, which drives the resolution of acute postoperative allodynia (By similarity).By similarity
<p>Manually curated information which has been propagated from a related experimentally characterized protein.</p>
<p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:Q9DBB1 (DUS6_MOUSE)1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Differential regulation of the MAP, SAP and RK/p38 kinases by Pyst1, a novel cytosolic dual-specificity phosphatase."_x005F_x005F_x000D_Groom L.A., Sneddon A.A., Alessi D.R., Dowd S., Keyse S.M._x005F_x005F_x000D_EMBO J. 15:3621-3632(1996) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, SUBCELLULAR LOCATION, VARIANT LEU-114. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.126 ng/mL |
Monoclonal MKP3 / DUSP6 Antibody (clone 3G2), Clone: 3G2 |
AMM06405G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human MKP3 / DUSP6 (clone 3G2). The antibodies are raised in Mouse and are from clone 3G2. This antibody is applicable in WB and IHC-P, IF, E, RNAi |
DUSP6 sgRNA CRISPR Lentivector set (Human) |
K0638401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dusp6 sgRNA CRISPR Lentivector set (Mouse) |
K5035001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dusp6 sgRNA CRISPR Lentivector set (Rat) |
K6936601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Dual Specificity Phosphatase 6 (DUSP6) |
4-RPF976Hu01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16828
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 36.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Dual Specificity Phosphatase 6 expressed in: E.coli |