Order Now: brent@sdlifesciences.com
 CYP26B1 Polyclonal Antibody |
|
ES8540-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CYP26B1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CYP26B1 Polyclonal Antibody |
|
ABP57547-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic peptide from human protein at AA range: 391-440
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440 |
CYP26B1 Polyclonal Antibody |
|
ABP57547-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic peptide from human protein at AA range: 391-440
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440 |
CYP26B1 Polyclonal Antibody |
|
ABP57547-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic peptide from human protein at AA range: 391-440
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440 |
 CYP26B1 Rabbit pAb |
|
A12142-100ul |
Abclonal |
100 ul |
EUR 308 |
CYP26B1 Rabbit pAb |
|
A12142-200ul |
Abclonal |
200 ul |
EUR 459 |
CYP26B1 Rabbit pAb |
|
A12142-20ul |
Abclonal |
20 ul |
EUR 183 |
CYP26B1 Rabbit pAb |
|
A12142-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal CYP26B1 Antibody (Internal) |
|
APG02880G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CYP26B1 (Internal). This antibody is tested and proven to work in the following applications: |
 CYP26B1 antibody |
|
70R-3226 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal CYP26B1 antibody raised against the N terminal of CYP26B1 |
CYP26B1 antibody |
|
70R-3388 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal CYP26B1 antibody raised against the middle region of CYP26B1 |
 CYP26B1 Antibody |
|
47001-100ul |
SAB |
100ul |
EUR 252 |
CYP26B1 antibody |
|
70R-16708 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal CYP26B1 antibody |
CYP26B1 Antibody |
|
DF12194 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CYP26B1 antibody detects endogenous levels of CYP26B1. |
CYP26B1 Antibody |
|
1-CSB-PA006403GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against CYP26B1. Recognizes CYP26B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
CYP26B1 Antibody |
|
1-CSB-PA770048 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
|
Description: A polyclonal antibody against CYP26B1. Recognizes CYP26B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000 |
 cyp26b1 Antibody |
|
1-CSB-PA721935LA01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
) Polyclonal CYP26B1 Antibody (internal region) |
|
APG02879G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CYP26B1 (internal region). This antibody is tested and proven to work in the following applications: |
 CYP26B1 Conjugated Antibody |
|
C47001 |
SAB |
100ul |
EUR 397 |
 anti- CYP26B1 antibody |
|
FNab02152 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: cytochrome P450, family 26, subfamily B, polypeptide 1
- Uniprot ID: Q9NR63
- Gene ID: 56603
- Research Area: Metabolism, Developmental biology
|
|
Description: Antibody raised against CYP26B1 |
 Anti-CYP26B1 antibody |
|
STJ98653 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to CYP26B1. |
Anti-CYP26B1 antibody |
|
STJ114035 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. |
 Polyclonal Antibody (Human)) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human) |
|
4-PAD541Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1) |
 CYP26B1 siRNA |
|
20-abx901381 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CYP26B1 siRNA |
|
20-abx913364 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CYP26B1 siRNA |
|
20-abx913365 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 cyp26b1 Antibody, HRP conjugated |
|
1-CSB-PA721935LB01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA |
 cyp26b1 Antibody, FITC conjugated |
|
1-CSB-PA721935LC01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA |
 cyp26b1 Antibody, Biotin conjugated |
|
1-CSB-PA721935LD01DIL |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Polyclonal Antibody (Human), APC) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), APC |
|
4-PAD541Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), Biotinylated |
|
4-PAD541Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), Cy3 |
|
4-PAD541Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), FITC |
|
4-PAD541Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), HRP |
|
4-PAD541Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), PE |
|
4-PAD541Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with PE. |
 ELISA kit) Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E04C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E04C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E04C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 CYP26B1 Blocking Peptide |
|
33R-5404 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYP26B1 antibody, catalog no. 70R-3226 |
CYP26B1 Blocking Peptide |
|
33R-8748 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYP26B1 antibody, catalog no. 70R-3388 |
CYP26B1 Blocking Peptide |
|
DF12194-BP |
Affbiotech |
1mg |
EUR 195 |
 CYP26B1 cloning plasmid |
|
CSB-CL885700HU1-10ug |
Cusabio |
10ug |
EUR 541 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1539
- Sequence: atgctctttgagggcttggatctggtgtcggcgctggccaccctcgccgcgtgcctggtgtccgtgacgctgctgctggccgtgtcgcagcagctgtggcagctgcgctgggccgccactcgcgacaagagctgcaagctgcccatccccaagggatccatgggcttcccgctca
- Show more
|
|
Description: A cloning plasmid for the CYP26B1 gene. |
CYP26B1 cloning plasmid |
|
CSB-CL885700HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1539
- Sequence: ATGCTCTTTGAGGGCTTGGATCTGGTGTCGGCGCTGGCCACCCTCGCCGCGTGCCTGGTGTCCGTGACGCTGCTGCTGGCCGTGTCGCAGCAGCTGTGGCAGCTGCGCTGGGCCGCCACTCGCGACAAGAGCTGCAAGCTGCCCATCCCCAAGGGATCCATGGGCTTCCCGCTCA
- Show more
|
|
Description: A cloning plasmid for the CYP26B1 gene. |
 Antibody) Cytochrome P450 26B1 (CYP26B1) Antibody |
|
20-abx125740 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cytochrome P450 26B1 (CYP26B1) Antibody |
|
20-abx111930 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cytochrome P450 26B1 (CYP26B1) Antibody |
|
20-abx128863 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cytochrome P450 26B1 (CYP26B1) Antibody |
|
20-abx329783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cytochrome P450 26B1 (CYP26B1) Antibody |
|
abx431758-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Cytochrome P450 26B1 (CYP26B1) Antibody |
|
abx232152-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAD541Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CYP26B1 (Met1~Val512)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with APC-Cy7. |
 Rat CYP26B1 shRNA Plasmid |
|
20-abx989722 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CYP26B1 shRNA Plasmid |
|
20-abx961148 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse CYP26B1 shRNA Plasmid |
|
20-abx981948 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CYP26B1 Recombinant Protein (Human) |
|
RP038392 |
ABM |
100 ug |
Ask for price |
CYP26B1 Recombinant Protein (Human) |
|
RP008614 |
ABM |
100 ug |
Ask for price |
) CYP26B1 Recombinant Protein (Rat) |
|
RP197060 |
ABM |
100 ug |
Ask for price |
) CYP26B1 Recombinant Protein (Mouse) |
|
RP127088 |
ABM |
100 ug |
Ask for price |
CYP26B1 Recombinant Protein (Mouse) |
|
RP127091 |
ABM |
100 ug |
Ask for price |
 (pORF)) CYP26B1 ORF Vector (Human) (pORF) |
|
ORF002872 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Cyp26b1 ORF Vector (Rat) (pORF) |
|
ORF065688 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Cyp26b1 ORF Vector (Mouse) (pORF) |
|
ORF042364 |
ABM |
1.0 ug DNA |
EUR 506 |
Cyp26b1 ORF Vector (Mouse) (pORF) |
|
ORF042365 |
ABM |
1.0 ug DNA |
EUR 506 |
CYP26B1 ORF Vector (Human) (pORF) |
|
ORF012798 |
ABM |
1.0 ug DNA |
EUR 354 |
) Recombinant Cytochrome P450 26B1 (CYP26B1) |
|
4-RPD541Hu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9NR63
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 61.3kDa
- Isoelectric Point: 8.8
|
|
Description: Recombinant Human Cytochrome P450 26B1 expressed in: E.coli |
) CYP26B1 sgRNA CRISPR Lentivector set (Human) |
|
K0556101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Protein) Human Cytochrome P450 26B1 (CYP26B1) Protein |
|
20-abx168263 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) Cyp26b1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4251501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cyp26b1 sgRNA CRISPR Lentivector set (Rat) |
|
K7255101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA kit) Goat Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E06C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E06C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E06C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E01C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E01C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E01C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rat Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E02C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E02C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E02C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E03C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E03C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E03C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E08C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E08C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E08C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E09C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E09C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E09C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Pig Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E07C2231-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E07C2231-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cytochrome P450 26B1(CYP26B1) ELISA kit |
|
E07C2231-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human Cytochrome P450 26B1, CYP26B1 ELISA KIT |
|
ELI-10389h |
Lifescience Market |
96 Tests |
EUR 824 |
 (Target 1)) CYP26B1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0556102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CYP26B1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0556103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CYP26B1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0556104 |
ABM |
1.0 ug DNA |
EUR 154 |
 ELISA Kit) Human Cytochrome P450 26B1 (CYP26B1) ELISA Kit |
|
abx386764-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (Target 1)) Cyp26b1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4251502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cyp26b1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4251503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cyp26b1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4251504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cyp26b1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7255102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cyp26b1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7255103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cyp26b1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7255104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CYP26B1 Protein Vector (Human) (pPB-C-His) |
|
PV051189 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) CYP26B1 Protein Vector (Human) (pPB-N-His) |
|
PV051190 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) CYP26B1 Protein Vector (Human) (pPM-C-HA) |
|
PV051191 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) CYP26B1 Protein Vector (Human) (pPM-C-His) |
|
PV051192 |
ABM |
500 ng |
EUR 481 |
CYP26B1 Protein Vector (Human) (pPB-C-His) |
|
PV011485 |
ABM |
500 ng |
EUR 329 |
CYP26B1 Protein Vector (Human) (pPB-N-His) |
|
PV011486 |
ABM |
500 ng |
EUR 329 |
CYP26B1 Protein Vector (Human) (pPM-C-HA) |
|
PV011487 |
ABM |
500 ng |
EUR 329 |
CYP26B1 Protein Vector (Human) (pPM-C-His) |
|
PV011488 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) CYP26B1 Protein Vector (Mouse) (pPB-C-His) |
|
PV169454 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CYP26B1 Protein Vector (Mouse) (pPB-N-His) |
|
PV169455 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CYP26B1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV169456 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CYP26B1 Protein Vector (Mouse) (pPM-C-His) |
|
PV169457 |
ABM |
500 ng |
EUR 603 |
CYP26B1 Protein Vector (Mouse) (pPB-C-His) |
|
PV169458 |
ABM |
500 ng |
EUR 603 |
CYP26B1 Protein Vector (Mouse) (pPB-N-His) |
|
PV169459 |
ABM |
500 ng |
EUR 603 |
CYP26B1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV169460 |
ABM |
500 ng |
EUR 603 |
CYP26B1 Protein Vector (Mouse) (pPM-C-His) |
|
PV169461 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CYP26B1 Protein Vector (Rat) (pPB-C-His) |
|
PV262750 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CYP26B1 Protein Vector (Rat) (pPB-N-His) |
|
PV262751 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CYP26B1 Protein Vector (Rat) (pPM-C-HA) |
|
PV262752 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CYP26B1 Protein Vector (Rat) (pPM-C-His) |
|
PV262753 |
ABM |
500 ng |
EUR 603 |
 Cyp26b1 3'UTR Luciferase Stable Cell Line |
|
TU203045 |
ABM |
1.0 ml |
Ask for price |
 Cyp26b1 3'UTR GFP Stable Cell Line |
|
TU154639 |
ABM |
1.0 ml |
Ask for price |
 CYP26B1 3'UTR Luciferase Stable Cell Line |
|
TU005508 |
ABM |
1.0 ml |
EUR 1521 |
Cyp26b1 3'UTR Luciferase Stable Cell Line |
|
TU104639 |
ABM |
1.0 ml |
Ask for price |
 CYP26B1 3'UTR GFP Stable Cell Line |
|
TU055508 |
ABM |
1.0 ml |
EUR 1521 |
Cyp26b1 3'UTR GFP Stable Cell Line |
|
TU253045 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
