Order Now: brent@sdlifesciences.com
CXCR4 Polyclonal Antibody |
EA281-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
CXCR4 Polyclonal Antibody |
EA281-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC |
CXCR4 Polyclonal Antibody |
ES8310-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
CXCR4 Polyclonal Antibody |
ES8310-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CXCR4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
CXCR4 Polyclonal Antibody |
ABP57317-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CXCR4 from Human, Mouse, Rat. This CXCR4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CXCR4 Polyclonal Antibody |
ABP57317-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CXCR4 from Human, Mouse, Rat. This CXCR4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CXCR4 Polyclonal Antibody |
ABP57317-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CXCR4 from Human, Mouse, Rat. This CXCR4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CXCR4 Polyclonal Antibody |
A50165 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CXCR4 Rabbit pAb |
A12534-100ul |
Abclonal |
100 ul |
EUR 308 |
CXCR4 Rabbit pAb |
A12534-200ul |
Abclonal |
200 ul |
EUR 459 |
CXCR4 Rabbit pAb |
A12534-20ul |
Abclonal |
20 ul |
EUR 183 |
CXCR4 Rabbit pAb |
A12534-50ul |
Abclonal |
50 ul |
EUR 223 |
CXCR4 Rabbit pAb |
A15112-100ul |
Abclonal |
100 ul |
EUR 308 |
CXCR4 Rabbit pAb |
A15112-200ul |
Abclonal |
200 ul |
EUR 459 |
CXCR4 Rabbit pAb |
A15112-20ul |
Abclonal |
20 ul |
EUR 183 |
CXCR4 Rabbit pAb |
A15112-50ul |
Abclonal |
50 ul |
EUR 223 |
CXCR4 Rabbit pAb |
A1303-100ul |
Abclonal |
100 ul |
EUR 308 |
CXCR4 Rabbit pAb |
A1303-200ul |
Abclonal |
200 ul |
EUR 459 |
CXCR4 Rabbit pAb |
A1303-20ul |
Abclonal |
20 ul |
EUR 183 |
CXCR4 Rabbit pAb |
A1303-50ul |
Abclonal |
50 ul |
EUR 223 |
CXCR4 Rabbit pAb |
A13672-100ul |
Abclonal |
100 ul |
EUR 308 |
CXCR4 Rabbit pAb |
A13672-200ul |
Abclonal |
200 ul |
EUR 459 |
CXCR4 Rabbit pAb |
A13672-20ul |
Abclonal |
20 ul |
EUR 183 |
CXCR4 Rabbit pAb |
A13672-50ul |
Abclonal |
50 ul |
EUR 223 |
CXCR4 Rabbit mAb |
A19035-100ul |
Abclonal |
100 ul |
EUR 410 |
CXCR4 Rabbit mAb |
A19035-200ul |
Abclonal |
200 ul |
EUR 571 |
CXCR4 Rabbit mAb |
A19035-20ul |
Abclonal |
20 ul |
EUR 221 |
CXCR4 Rabbit mAb |
A19035-50ul |
Abclonal |
50 ul |
EUR 287 |
Polyclonal CXCR4 (extracellular) Antibody |
APG02835G |
Leading Biology |
0.05ml |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (extracellular) . This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody(N-term) |
APR10833G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (N-term) |
AMM08772G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (aa13-38) |
APG02837G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CXCR4 (aa13-38). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (aa14-40) |
APG02838G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CXCR4 (aa14-40). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (Cytoplasmic Domain) |
APG02839G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (Cytoplasmic Domain) |
APG02840G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (N-Terminus) |
APG02841G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (N-Terminus) |
APG02842G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal CXCR4 Antibody (N-term) |
APC00089G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 (N-term). This antibody is tested and proven to work in the following applications: |
CXCR4 Polyclonal Antibody, HRP Conjugated |
A50166 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CXCR4 Polyclonal Antibody, FITC Conjugated |
A50167 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
CXCR4 Polyclonal Antibody, Biotin Conjugated |
A50168 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CXCR4 Antibody |
AF5279 |
Affbiotech |
200ul |
EUR 304 |
Description: CXCR4 Antibody detects endogenous levels of total CXCR4. |
CXCR4 Antibody |
AF7829 |
Affbiotech |
200ul |
EUR 376 |
Description: CXCR4 Antibody detects endogenous levels of CXCR4. |
CXCR4 Antibody |
abx140472-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 5-12 working days.
|
CXCR4 antibody |
70R-30897 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CXCR4 antibody |
CXCR4 antibody |
70R-CR011 |
Fitzgerald |
200 ug |
EUR 435 |
Description: Affinity purified Rabbit polyclonal CXCR4 antibody |
CXCR4 antibody |
70R-7849 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CXCR4 antibody |
CXCR4 Antibody |
36326-100ul |
SAB |
100ul |
EUR 252 |
CXCR4 antibody |
20R-CG008 |
Fitzgerald |
200 ug |
EUR 543 |
Description: Goat polyclonal CXCR4 antibody |
CXCR4 Antibody |
24002-100ul |
SAB |
100ul |
EUR 390 |
CXCR4 Antibody |
24003-100ul |
SAB |
100ul |
EUR 390 |
CXCR4 antibody |
20R-1808 |
Fitzgerald |
100 ug |
EUR 673 |
Description: Rabbit polyclonal CXCR4 antibody |
CXCR4 antibody |
70R-12301 |
Fitzgerald |
100 ug |
EUR 447 |
Description: Rabbit polyclonal CXCR4 antibody |
CXCR4 antibody |
70R-12359 |
Fitzgerald |
100 ug |
EUR 436 |
Description: Rabbit polyclonal CXCR4 antibody |
CXCR4 antibody |
70R-13830 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Goat polyclonal CXCR4 antibody |
CXCR4 antibody |
70R-16688 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CXCR4 antibody |
CXCR4 Antibody |
DF8046 |
Affbiotech |
200ul |
EUR 304 |
Description: CXCR4 Antibody detects endogenous levels of total CXCR4. |
CXCR4 Antibody |
1-CSB-PA996565 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
CXCR4 Antibody |
1-CSB-PA006254GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CXCR4 Antibody |
1-CSB-PA006254YA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
CXCR4 Antibody |
1-CSB-PA002588 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000 |
CXCR4 Antibody |
1-CSB-PA250029 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
CXCR4 Antibody |
1-CSB-PA263860 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CXCR4 Antibody |
1-CSB-PA099227 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
DLR-CXCR4-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
DLR-CXCR4-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
DLR-CXCR4-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
DLR-CXCR4-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
DLR-CXCR4-p-48T |
DL Develop |
48T |
EUR 547 |
- Should the Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates or other biological fluids. |
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
DLR-CXCR4-p-96T |
DL Develop |
96T |
EUR 715 |
- Should the Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) in samples from tissue homogenates or other biological fluids. |
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RDR-CXCR4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RDR-CXCR4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RDR-CXCR4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RDR-CXCR4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RDR-CXCR4-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 580 |
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RDR-CXCR4-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 807 |
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RD-CXCR4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RD-CXCR4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RD-CXCR4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RD-CXCR4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RD-CXCR4-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 555 |
Porcine Chemokine C-X-C-Motif Receptor 4 (CXCR4) ELISA Kit |
RD-CXCR4-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 771 |
Polyclonal CXCR4 antibody - N-terminal region |
APG02843G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXCR4 - N-terminal region. This antibody is tested and proven to work in the following applications: |
CXCR4 Conjugated Antibody |
C36326 |
SAB |
100ul |
EUR 397 |
anti- CXCR4 antibody |
FNab02102 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: chemokine (C-X-C motif) receptor 4
- Uniprot ID: P61073
- Gene ID: 7852
- Research Area: Signal Transduction, Immunology, Developmental biology, Neuroscience, Stem Cells
|
Description: Antibody raised against CXCR4 |
anti- CXCR4 antibody |
FNab02103 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- Immunogen: chemokine(C-X-C motif) receptor 4
- Uniprot ID: P61073
- Gene ID: 7852
- Research Area: Signal Transduction, Immunology, Developmental biology, Neuroscience, Stem Cells
|
Description: Antibody raised against CXCR4 |
Anti-CXCR4 Antibody |
A00031-2 |
BosterBio |
100ug/vial |
EUR 294 |
CXCR4 antibody (Ser339) |
70R-33523 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CXCR4 antibody (Ser339) |
CXCR4-Lo Antibody |
24624-100ul |
SAB |
100ul |
EUR 390 |
Anti-CXCR4 Antibody |
PA1237 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-CXCR4 Antibody |
PA2081 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-CXCR4 antibody |
STJ97564 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CXCR4 (A220). |
Anti-CXCR4 antibody |
STJ23304 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. |
Anti-CXCR4 antibody |
STJ114408 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. |
Anti-CXCR4 antibody |
STJ117306 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. |
Anti-CXCR4 antibody |
STJ115628 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. |
CXCR4 siRNA |
20-abx913265 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CXCR4 siRNA |
20-abx913266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CXCR4 |
YF-PA15478 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CXCR4 |
CXCR4 Antibody, HRP conjugated |
1-CSB-PA006254YB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CXCR4 Antibody, FITC conjugated |
1-CSB-PA006254YC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CXCR4 Antibody, Biotin conjugated |
1-CSB-PA006254YD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CXCR4. Recognizes CXCR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-CXCR4 (S339) Antibody |
1-CSB-PA060127 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-CXCR4 (S339). Recognizes Phospho-CXCR4 (S339) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
Anti-CXCR4 Monoclonal Antibody |
M00031 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal CXCR4 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse. |
Antibody for Human CXCR4 |
SPC-1293D |
Stressmarq |
0.1ml |
EUR 314 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is unconjugated. |
Antibody for Human CXCR4 |
SPC-1293D-A390 |
Stressmarq |
0.1ml |
EUR 361 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 390. |
Antibody for Human CXCR4 |
SPC-1293D-A488 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 488. |
Antibody for Human CXCR4 |
SPC-1293D-A565 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 565. |
Antibody for Human CXCR4 |
SPC-1293D-A594 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 594. |
Antibody for Human CXCR4 |
SPC-1293D-A633 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 633. |
Antibody for Human CXCR4 |
SPC-1293D-A655 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 655. |
Antibody for Human CXCR4 |
SPC-1293D-A680 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 680. |
Antibody for Human CXCR4 |
SPC-1293D-A700 |
Stressmarq |
0.1ml |
EUR 360 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to ATTO 700. |
Antibody for Human CXCR4 |
SPC-1293D-ALP |
Stressmarq |
0.1ml |
EUR 355 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human CXCR4 |
SPC-1293D-APC |
Stressmarq |
0.1ml |
EUR 359 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to APC . |
Antibody for Human CXCR4 |
SPC-1293D-APCCY7 |
Stressmarq |
0.1ml |
EUR 432 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to APC/Cy7. |
Antibody for Human CXCR4 |
SPC-1293D-BI |
Stressmarq |
0.1ml |
EUR 357 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Biotin. |
Antibody for Human CXCR4 |
SPC-1293D-DY350 |
Stressmarq |
0.1ml |
EUR 436 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 350. |
Antibody for Human CXCR4 |
SPC-1293D-DY405 |
Stressmarq |
0.1ml |
EUR 412 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 405. |
Antibody for Human CXCR4 |
SPC-1293D-DY488 |
Stressmarq |
0.1ml |
EUR 393 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 488. |
Antibody for Human CXCR4 |
SPC-1293D-DY594 |
Stressmarq |
0.1ml |
EUR 397 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 594. |
Antibody for Human CXCR4 |
SPC-1293D-DY633 |
Stressmarq |
0.1ml |
EUR 387 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Dylight 633. |
Antibody for Human CXCR4 |
SPC-1293D-FITC |
Stressmarq |
0.1ml |
EUR 353 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to FITC. |
Antibody for Human CXCR4 |
SPC-1293D-HRP |
Stressmarq |
0.1ml |
EUR 349 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to HRP. |
Antibody for Human CXCR4 |
SPC-1293D-P594 |
Stressmarq |
0.1ml |
EUR 367 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to PE/ATTO 594. |
Antibody for Human CXCR4 |
SPC-1293D-PCP |
Stressmarq |
0.1ml |
EUR 359 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to PerCP. |
Antibody for Human CXCR4 |
SPC-1293D-RPE |
Stressmarq |
0.1ml |
EUR 358 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to RPE . |
Antibody for Human CXCR4 |
SPC-1293D-STR |
Stressmarq |
0.1ml |
EUR 359 |
- C-X-C chemokine receptor type 4 (CXCR-4) is a protein that in humans is encoded by the CXCR4 gene, also known as fusin or CD184 (cluster of differentiation 184). Chemokines and their receptors direct migration of distinct leukocyte subsets to sites o
- Show more
|
Description: A polyclonal antibody for CXCR4 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human CXCR4. The Antibody is tested and validated for WB, IHC assays with the following recommended dilutions: WB (1:2000), IHC (1:200). This CXCR4 antibody is conjugated to Streptavidin. |
Phospho-CXCR4 (Ser338/339) Antibody |
AF7329 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-CXCR4 (Ser338/339) Antibody detects endogenous levels of CXCR4 only when phosphorylated at Ser338/339. |
CXCR4 (Phospho-Ser338/339) Antibody |
13178-100ul |
SAB |
100ul |
EUR 252 |
CXCR4 (Phospho-Ser338/339) Antibody |
13178-50ul |
SAB |
50ul |
EUR 187 |
CXCR4 Blocking Peptide |
AF5279-BP |
Affbiotech |
1mg |
EUR 195 |
CXCR4 Blocking Peptide |
AF7829-BP |
Affbiotech |
1mg |
EUR 195 |
CXCR4 cloning plasmid |
CSB-CL006254HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1059
- Sequence: atggaggggatcagtatatacacttcagataactacaccgaggaaatgggctcaggggactatgactccatgaaggaaccctgtttccgtgaagaaaatgctaatttcaataaaatcttcctgcccaccatctactccatcatcttcttaactggcattgtgggcaatggattgg
- Show more
|
Description: A cloning plasmid for the CXCR4 gene. |