Order Now: brent@sdlifesciences.com
CSH1 Polyclonal Antibody |
ABP57546-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic peptide from human protein at AA range: 161-210
- Applications tips:
|
Description: A polyclonal antibody for detection of CSH1 from Human. This CSH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 161-210 |
CSH1 Polyclonal Antibody |
ABP57546-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic peptide from human protein at AA range: 161-210
- Applications tips:
|
Description: A polyclonal antibody for detection of CSH1 from Human. This CSH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 161-210 |
CSH1 Polyclonal Antibody |
A57619 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CSH1 Rabbit pAb |
A1972-100ul |
Abclonal |
100 ul |
EUR 308 |
CSH1 Rabbit pAb |
A1972-200ul |
Abclonal |
200 ul |
EUR 459 |
CSH1 Rabbit pAb |
A1972-20ul |
Abclonal |
20 ul |
EUR 183 |
CSH1 Rabbit pAb |
A1972-50ul |
Abclonal |
50 ul |
EUR 223 |
CSH1 Rabbit pAb |
A14528-100ul |
Abclonal |
100 ul |
EUR 308 |
CSH1 Rabbit pAb |
A14528-200ul |
Abclonal |
200 ul |
EUR 459 |
CSH1 Rabbit pAb |
A14528-20ul |
Abclonal |
20 ul |
EUR 183 |
CSH1 Rabbit pAb |
A14528-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit |
DLR-CSH1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Chorionic Somatomammotropin Hormone 1 (CSH1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit |
DLR-CSH1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Chorionic Somatomammotropin Hormone 1 (CSH1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit |
RDR-CSH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit |
RDR-CSH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit |
RD-CSH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit |
RD-CSH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
CSH1 Antibody |
20-abx324979 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CSH1 Antibody |
36527-100ul |
SAB |
100ul |
EUR 252 |
CSH1 antibody |
38328-100ul |
SAB |
100ul |
EUR 252 |
CSH1 antibody |
70R-1711 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal CSH1 antibody |
CSH1 antibody |
70R-16617 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CSH1 antibody |
CSH1 Antibody |
1-CSB-PA006053GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CSH1 Antibody |
1-CSB-PA366814 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000 |
CSH1 Antibody |
1-CSB-PA696449 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
CSH1 Antibody |
1-CSB-PA077659 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
CSH1 Antibody |
1-CSB-PA11377A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Polyclonal CSH1 Antibody (C-term) |
APR15610G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSH1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal CSH1 Antibody (N-term) |
APR15611G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSH1 (N-term). This antibody is tested and proven to work in the following applications: |
CSH1 Polyclonal Antibody, HRP Conjugated |
A57620 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
CSH1 Polyclonal Antibody, FITC Conjugated |
A57621 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CSH1 Polyclonal Antibody, Biotin Conjugated |
A57622 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CSH1 Conjugated Antibody |
C36527 |
SAB |
100ul |
EUR 397 |
CSH1 Conjugated Antibody |
C38328 |
SAB |
100ul |
EUR 397 |
Anti-CSH1 antibody |
STJ98652 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CSH1. |
Anti-CSH1 antibody |
STJ23239 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome. |
Anti-CSH1 antibody |
STJ116739 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome. |
CSH1 siRNA |
20-abx912932 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Placental Lactogen (CSH1) ELISA Kit |
abx363824-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Placental Lactogen (CSH1) Antibody |
20-abx111620 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
20-abx128770 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Placental Lactogen (CSH1) Antibody |
20-abx110398 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
20-abx001607 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
abx145032-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
abx025992-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
abx025992-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
abx031424-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
abx031424-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
abx411545-1ml |
Abbexa |
1 ml |
EUR 370 |
|
Placental Lactogen (CSH1) Antibody |
abx414682-05mg |
Abbexa |
0.5 mg |
EUR 662 |
|
Placental Lactogen (CSH1) Antibody |
abx236512-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Placental Lactogen (CSH1) Antibody |
abx236513-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Placental Lactogen (CSH1) Antibody |
abx236514-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Placental Lactogen (CSH1) Antibody |
20-abx211225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody |
20-abx211226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CSH1 Antibody, HRP conjugated |
1-CSB-PA11377B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CSH1 Antibody, FITC conjugated |
1-CSB-PA11377C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CSH1 Antibody, Biotin conjugated |
1-CSB-PA11377D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CSH1 cloning plasmid |
CSB-CL006053HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttcccttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga
- Show more
|
Description: A cloning plasmid for the CSH1 gene. |
CSH1 cloning plasmid |
CSB-CL006053HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga
- Show more
|
Description: A cloning plasmid for the CSH1 gene. |
CSH1 cloning plasmid |
CSB-CL006053HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga
- Show more
|
Description: A cloning plasmid for the CSH1 gene. |
CSH1 Blocking Peptide |
33R-8635 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CSH1 antibody, catalog no. 70R-1711 |
Placental Lactogen (CSH1) Antibody (HRP) |
20-abx108952 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody (Biotin) |
20-abx106119 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Placental Lactogen (CSH1) Antibody (FITC) |
20-abx107533 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-CSH1/Placental Lactogen Antibody |
A05177 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for CSH1 Antibody (CSH1) detection. Tested with WB in Human. |
Human CSH1 shRNA Plasmid |
20-abx951016 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CSH1 protein (His tag) |
80R-3411 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant CSH1 protein (His tag) |
CSH1 Recombinant Protein (Human) |
RP008149 |
ABM |
100 ug |
Ask for price |
CSH1 Recombinant Protein (Human) |
RP008152 |
ABM |
100 ug |
Ask for price |
CSH1 Recombinant Protein (Human) |
RP008155 |
ABM |
100 ug |
Ask for price |
Human Placental Lactogen (CSH1) Protein |
20-abx166668 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CSH1 ORF Vector (Human) (pORF) |
ORF002717 |
ABM |
1.0 ug DNA |
EUR 95 |
CSH1 ORF Vector (Human) (pORF) |
ORF002718 |
ABM |
1.0 ug DNA |
EUR 95 |
CSH1 ORF Vector (Human) (pORF) |
ORF002719 |
ABM |
1.0 ug DNA |
EUR 95 |
CSH1 ELISA Kit (Human) (OKEH00852) |
OKEH00852 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL |
CSH1 ELISA Kit (Bovine) (OKEH07779) |
OKEH07779 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.061ng/mL |
Monkey Placental Lactogen (CSH1) ELISA Kit |
abx359960-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Placental Lactogen (CSH1) ELISA Kit |
abx361712-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Cow Placental Lactogen (CSH1) ELISA Kit |
abx515676-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Placental Lactogen (CSH1) ELISA Kit |
abx575332-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
CSH1 sgRNA CRISPR Lentivector set (Human) |
K0515801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Placental Lactogen (CSH1) ELISA Kit |
20-abx152767 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Sheep Placental Lactogen (CSH1) ELISA Kit |
abx259352-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Placental Lactogen (CSH1) ELISA Kit |
abx252988-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Chorionic somatomammotropin hormone protein (CSH1) |
1-CSB-RP113774h(A4) |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 26.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Chorionic somatomammotropin hormone protein(CSH1) expressed in E.coli |
h CSH1 (6His) inducible lentiviral particles |
LVP1103 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CSH1 (6His) (human chorionic somatomammotropin hormone 1), [alternative names: CS-1; CSA; CSMT; GHB3; hCS-1; hCS-A; PL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001317.5 . It also contains a RFP-Blasticidin dual selection marker. |
Recombinant Human Placental Lactogen/CSH1 (C-6His) |
C457-10ug |
Novoprotein |
10ug |
EUR 168 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Placental Lactogen/CSH1 (C-6His) |
C457-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Placental Lactogen/CSH1 (C-6His) |
C457-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Recombinant Human Placental Lactogen/CSH1 (C-6His) |
C457-50ug |
Novoprotein |
50ug |
EUR 405 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2. |
Human CSH1/ Chorionic somatomammotropin hormone ELISA Kit |
E0573Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Chorionic somatomammotropin hormone, CSH1 ELISA KIT |
ELI-03932h |
Lifescience Market |
96 Tests |
EUR 824 |
CSH1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0515802 |
ABM |
1.0 ug DNA |
EUR 154 |
CSH1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0515803 |
ABM |
1.0 ug DNA |
EUR 154 |
CSH1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0515804 |
ABM |
1.0 ug DNA |
EUR 154 |
Bovine chorionic somatomammotropin hormone (CSH1) ELISA kit |
CSB-EL006053BO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Bovine chorionic somatomammotropin hormone (CSH1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Bovine chorionic somatomammotropin hormone (CSH1) ELISA kit |
1-CSB-EL006053BO |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Bovine chorionic somatomammotropin hormone (CSH1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
CSH1 Protein Vector (Human) (pPB-C-His) |
PV010865 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPB-N-His) |
PV010866 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPM-C-HA) |
PV010867 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPM-C-His) |
PV010868 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPB-C-His) |
PV010869 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPB-N-His) |
PV010870 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPM-C-HA) |
PV010871 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPM-C-His) |
PV010872 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPB-C-His) |
PV010873 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPB-N-His) |
PV010874 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPM-C-HA) |
PV010875 |
ABM |
500 ng |
EUR 329 |
CSH1 Protein Vector (Human) (pPM-C-His) |
PV010876 |
ABM |
500 ng |
EUR 329 |
CSH1 3'UTR Luciferase Stable Cell Line |
TU005101 |
ABM |
1.0 ml |
EUR 1394 |
CSH1 3'UTR GFP Stable Cell Line |
TU055101 |
ABM |
1.0 ml |
EUR 1394 |
Bovine Chorionic somatomammotropin hormone 1, CSH1 ELISA KIT |
ELI-03931b |
Lifescience Market |
96 Tests |
EUR 928 |
Bovine CSH1/ Chorionic somatomammotropin hormone 1 ELISA Kit |
E0072Bo |
Sunlong |
1 Kit |
EUR 717 |
CSH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV709023 |
ABM |
1.0 ug DNA |
EUR 316 |
CSH1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV709027 |
ABM |
1.0 ug DNA |
EUR 316 |
CSH1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV709028 |
ABM |
1.0 ug DNA |
EUR 316 |
CSH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV709029 |
ABM |
1.0 ug DNA |
EUR 316 |
CSH1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV709033 |
ABM |
1.0 ug DNA |
EUR 316 |
CSH1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV709034 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |