CSH1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

CSH1 Polyclonal Antibody
ABP57546-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 161-210 Applications tips:
Description: A polyclonal antibody for detection of CSH1 from Human. This CSH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 161-210

CSH1 Polyclonal Antibody
ES8539-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CSH1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CSH1 Polyclonal Antibody
ES8539-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CSH1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CSH1 Rabbit pAb
A14528-100ul	Abclonal	100 ul	EUR 308

CSH1 Rabbit pAb
A14528-200ul	Abclonal	200 ul	EUR 459

CSH1 Rabbit pAb
A14528-20ul	Abclonal	20 ul	EUR 183

CSH1 Rabbit pAb
A14528-50ul	Abclonal	50 ul	EUR 223

CSH1 Rabbit pAb
A1972-100ul	Abclonal	100 ul	EUR 308

CSH1 Rabbit pAb
A1972-200ul	Abclonal	200 ul	EUR 459

CSH1 Rabbit pAb
A1972-20ul	Abclonal	20 ul	EUR 183

CSH1 Rabbit pAb
A1972-50ul	Abclonal	50 ul	EUR 223

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit
DLR-CSH1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chorionic Somatomammotropin Hormone 1 (CSH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit
DLR-CSH1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chorionic Somatomammotropin Hormone 1 (CSH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit
RDR-CSH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit
RDR-CSH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit
RD-CSH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit
RD-CSH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

CSH1 antibody
70R-16617	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CSH1 antibody

CSH1 antibody
70R-1711	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal CSH1 antibody

CSH1 Antibody
36527-100ul	SAB	100ul	EUR 252

CSH1 antibody
38328-100ul	SAB	100ul	EUR 252

CSH1 Antibody
1-CSB-PA006053GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CSH1 Antibody
1-CSB-PA077659	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CSH1 Antibody
1-CSB-PA11377A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CSH1 Antibody
1-CSB-PA696449	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CSH1 Antibody
1-CSB-PA366814	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

CSH1 Antibody
20-abx324979	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Polyclonal CSH1 Antibody (C-term)
APR15610G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSH1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal CSH1 Antibody (N-term)
APR15611G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSH1 (N-term). This antibody is tested and proven to work in the following applications:

CSH1 Polyclonal Antibody, HRP Conjugated
A57620	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CSH1 Polyclonal Antibody, FITC Conjugated
A57621	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CSH1 Polyclonal Antibody, Biotin Conjugated
A57622	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CSH1 Conjugated Antibody
C36527	SAB	100ul	EUR 397

CSH1 Conjugated Antibody
C38328	SAB	100ul	EUR 397

Anti-CSH1 antibody
STJ116739	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.

Anti-CSH1 antibody
STJ23239	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.

Anti-CSH1 antibody
STJ98652	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to CSH1.

CSH1 siRNA
20-abx912932	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rabbit Placental Lactogen (CSH1) ELISA Kit
abx363824-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

CSH1 Antibody, HRP conjugated
1-CSB-PA11377B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CSH1 Antibody, FITC conjugated
1-CSB-PA11377C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CSH1 Antibody, Biotin conjugated
1-CSB-PA11377D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Placental Lactogen (CSH1) Antibody
abx025992-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
abx025992-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
20-abx211225	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
20-abx211226	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
20-abx110398	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
20-abx111620	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
20-abx128770	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Placental Lactogen (CSH1) Antibody
abx145032-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
abx031424-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
abx031424-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody
abx411545-1ml	Abbexa	1 ml	EUR 370
Shipped within 1 week.

Placental Lactogen (CSH1) Antibody
abx414682-05mg	Abbexa	0.5 mg	EUR 662
Shipped within 1 week.

Placental Lactogen (CSH1) Antibody
abx236512-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Placental Lactogen (CSH1) Antibody
abx236513-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Placental Lactogen (CSH1) Antibody
abx236514-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Placental Lactogen (CSH1) Antibody
20-abx001607	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

CSH1 Blocking Peptide
33R-8635	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CSH1 antibody, catalog no. 70R-1711

CSH1 cloning plasmid
CSB-CL006053HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 654 Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttcccttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga Show more
Description: A cloning plasmid for the CSH1 gene.

CSH1 cloning plasmid
CSB-CL006053HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 654 Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga Show more
Description: A cloning plasmid for the CSH1 gene.

CSH1 cloning plasmid
CSB-CL006053HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 654 Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga Show more
Description: A cloning plasmid for the CSH1 gene.

Anti-CSH1/Placental Lactogen Antibody
A05177	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CSH1 Antibody (CSH1) detection. Tested with WB in Human.

Placental Lactogen (CSH1) Antibody (Biotin)
20-abx106119	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody (FITC)
20-abx107533	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody (HRP)
20-abx108952	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CSH1 protein (His tag)
80R-3411	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant CSH1 protein (His tag)

Human CSH1 ELISA Kit
ELA-E1191h	Lifescience Market	96 Tests	EUR 824

Human CSH1 shRNA Plasmid
20-abx951016	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CSH1 Recombinant Protein (Human)
RP008149	ABM	100 ug	Ask for price

CSH1 Recombinant Protein (Human)
RP008152	ABM	100 ug	Ask for price

CSH1 Recombinant Protein (Human)
RP008155	ABM	100 ug	Ask for price

Human Placental Lactogen (CSH1) Protein
20-abx166668	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CSH1 ORF Vector (Human) (pORF)
ORF002717	ABM	1.0 ug DNA	EUR 95

CSH1 ORF Vector (Human) (pORF)
ORF002718	ABM	1.0 ug DNA	EUR 95

CSH1 ORF Vector (Human) (pORF)
ORF002719	ABM	1.0 ug DNA	EUR 95

CSH1 ELISA Kit (Human) (OKEH00852)
OKEH00852	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL

CSH1 ELISA Kit (Bovine) (OKEH07779)
OKEH07779	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.061ng/mL

Human Chorionic somatomammotropin hormone protein (CSH1)
1-CSB-RP113774h(A4)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 26.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chorionic somatomammotropin hormone protein(CSH1) expressed in E.coli

Human Placental Lactogen (CSH1) ELISA Kit
20-abx152767	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Sheep Placental Lactogen (CSH1) ELISA Kit
abx259352-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Placental Lactogen (CSH1) ELISA Kit
abx252988-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Monkey Placental Lactogen (CSH1) ELISA Kit
abx359960-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Placental Lactogen (CSH1) ELISA Kit
abx361712-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Placental Lactogen (CSH1) ELISA Kit
abx575332-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Cow Placental Lactogen (CSH1) ELISA Kit
abx515676-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

CSH1 sgRNA CRISPR Lentivector set (Human)
K0515801	ABM	3 x 1.0 ug	EUR 339

h CSH1 (6His) inducible lentiviral particles
LVP1103	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CSH1 (6His) (human chorionic somatomammotropin hormone 1), [alternative names: CS-1; CSA; CSMT; GHB3; hCS-1; hCS-A; PL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001317.5 . It also contains a RFP-Blasticidin dual selection marker.

Human CSH1/ Chorionic somatomammotropin hormone ELISA Kit
E0573Hu	Sunlong	1 Kit	EUR 571

Human Chorionic somatomammotropin hormone, CSH1 ELISA KIT
ELI-03932h	Lifescience Market	96 Tests	EUR 824

Bovine chorionic somatomammotropin hormone (CSH1) ELISA kit
CSB-EL006053BO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine chorionic somatomammotropin hormone (CSH1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine chorionic somatomammotropin hormone (CSH1) ELISA kit
1-CSB-EL006053BO	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine chorionic somatomammotropin hormone (CSH1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Recombinant Human Placental Lactogen/CSH1 (C-6His)
C457-10ug	Novoprotein	10ug	EUR 168
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Placental Lactogen/CSH1 (C-6His)
C457-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Placental Lactogen/CSH1 (C-6His)
C457-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Placental Lactogen/CSH1 (C-6His)
C457-50ug	Novoprotein	50ug	EUR 405
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

CSH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0515802	ABM	1.0 ug DNA	EUR 154

CSH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0515803	ABM	1.0 ug DNA	EUR 154

CSH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0515804	ABM	1.0 ug DNA	EUR 154

CSH1 Protein Vector (Human) (pPB-C-His)
PV010865	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPB-N-His)
PV010866	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPM-C-HA)
PV010867	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPM-C-His)
PV010868	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPB-C-His)
PV010869	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPB-N-His)
PV010870	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPM-C-HA)
PV010871	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPM-C-His)
PV010872	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPB-C-His)
PV010873	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPB-N-His)
PV010874	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPM-C-HA)
PV010875	ABM	500 ng	EUR 329

CSH1 Protein Vector (Human) (pPM-C-His)
PV010876	ABM	500 ng	EUR 329

CSH1 3'UTR GFP Stable Cell Line
TU055101	ABM	1.0 ml	EUR 1394

CSH1 3'UTR Luciferase Stable Cell Line
TU005101	ABM	1.0 ml	EUR 1394

Bovine CSH1/ Chorionic somatomammotropin hormone 1 ELISA Kit
E0072Bo	Sunlong	1 Kit	EUR 717

Bovine Chorionic somatomammotropin hormone 1, CSH1 ELISA KIT
ELI-03931b	Lifescience Market	96 Tests	EUR 928

CSH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709023	ABM	1.0 ug DNA	EUR 316

CSH1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709027	ABM	1.0 ug DNA	EUR 316

CSH1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV709028	ABM	1.0 ug DNA	EUR 316

CSH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709029	ABM	1.0 ug DNA	EUR 316

CSH1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709033	ABM	1.0 ug DNA	EUR 316

CSH1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV709034	ABM	1.0 ug DNA	EUR 316

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3