CSH1 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

CSH1 Polyclonal Antibody

ABP57546-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 161-210
  • Applications tips:
Description: A polyclonal antibody for detection of CSH1 from Human. This CSH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 161-210

CSH1 Polyclonal Antibody

ES8539-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CSH1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CSH1 Polyclonal Antibody

ES8539-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CSH1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CSH1 Rabbit pAb

A14528-100ul 100 ul
EUR 308

CSH1 Rabbit pAb

A14528-200ul 200 ul
EUR 459

CSH1 Rabbit pAb

A14528-20ul 20 ul
EUR 183

CSH1 Rabbit pAb

A14528-50ul 50 ul
EUR 223

CSH1 Rabbit pAb

A1972-100ul 100 ul
EUR 308

CSH1 Rabbit pAb

A1972-200ul 200 ul
EUR 459

CSH1 Rabbit pAb

A1972-20ul 20 ul
EUR 183

CSH1 Rabbit pAb

A1972-50ul 50 ul
EUR 223

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit

DLR-CSH1-Hu-48T 48T
EUR 479
  • Should the Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chorionic Somatomammotropin Hormone 1 (CSH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit

DLR-CSH1-Hu-96T 96T
EUR 621
  • Should the Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chorionic Somatomammotropin Hormone 1 (CSH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit

RDR-CSH1-Hu-48Tests 48 Tests
EUR 500

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit

RDR-CSH1-Hu-96Tests 96 Tests
EUR 692

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit

RD-CSH1-Hu-48Tests 48 Tests
EUR 478

Human Chorionic Somatomammotropin Hormone 1 (CSH1) ELISA Kit

RD-CSH1-Hu-96Tests 96 Tests
EUR 662

CSH1 antibody

70R-16617 50 ul
EUR 435
Description: Rabbit polyclonal CSH1 antibody

CSH1 antibody

70R-1711 100 ug
EUR 377
Description: Rabbit polyclonal CSH1 antibody

CSH1 Antibody

36527-100ul 100ul
EUR 252

CSH1 antibody

38328-100ul 100ul
EUR 252

CSH1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CSH1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CSH1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CSH1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CSH1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

CSH1 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal CSH1 Antibody (C-term)

APR15610G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSH1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal CSH1 Antibody (N-term)

APR15611G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSH1 (N-term). This antibody is tested and proven to work in the following applications:

CSH1 Polyclonal Antibody, HRP Conjugated

A57620 100 µg
EUR 570.55
Description: reagents widely cited

CSH1 Polyclonal Antibody, FITC Conjugated

A57621 100 µg
EUR 570.55
Description: Ask the seller for details

CSH1 Polyclonal Antibody, Biotin Conjugated

A57622 100 µg
EUR 570.55
Description: The best epigenetics products

CSH1 Conjugated Antibody

C36527 100ul
EUR 397

CSH1 Conjugated Antibody

C38328 100ul
EUR 397

Anti-CSH1 antibody

STJ116739 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.

Anti-CSH1 antibody

STJ23239 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.

Anti-CSH1 antibody

STJ98652 200 µl
EUR 197
Description: Rabbit polyclonal to CSH1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Placental Lactogen (CSH1) ELISA Kit

abx363824-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CSH1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CSH1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CSH1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSH1. Recognizes CSH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Placental Lactogen (CSH1) Antibody

abx025992-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

abx025992-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Placental Lactogen (CSH1) Antibody

abx145032-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

abx031424-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

abx031424-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody

abx411545-1ml 1 ml
EUR 370
  • Shipped within 1 week.

Placental Lactogen (CSH1) Antibody

abx414682-05mg 0.5 mg
EUR 662
  • Shipped within 1 week.

Placental Lactogen (CSH1) Antibody

abx236512-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Placental Lactogen (CSH1) Antibody

abx236513-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Placental Lactogen (CSH1) Antibody

abx236514-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Placental Lactogen (CSH1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CSH1 Blocking Peptide

33R-8635 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CSH1 antibody, catalog no. 70R-1711

CSH1 cloning plasmid

CSB-CL006053HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttcccttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga
  • Show more
Description: A cloning plasmid for the CSH1 gene.

CSH1 cloning plasmid

CSB-CL006053HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga
  • Show more
Description: A cloning plasmid for the CSH1 gene.

CSH1 cloning plasmid

CSB-CL006053HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaaga
  • Show more
Description: A cloning plasmid for the CSH1 gene.

Anti-CSH1/Placental Lactogen Antibody

A05177 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CSH1 Antibody (CSH1) detection. Tested with WB in Human.

Placental Lactogen (CSH1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Placental Lactogen (CSH1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CSH1 protein (His tag)

80R-3411 50 ug
EUR 257
Description: Purified recombinant CSH1 protein (His tag)

Human CSH1 ELISA Kit

ELA-E1191h 96 Tests
EUR 824

Human CSH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CSH1 Recombinant Protein (Human)

RP008149 100 ug Ask for price

CSH1 Recombinant Protein (Human)

RP008152 100 ug Ask for price

CSH1 Recombinant Protein (Human)

RP008155 100 ug Ask for price

Human Placental Lactogen (CSH1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CSH1 ORF Vector (Human) (pORF)

ORF002717 1.0 ug DNA
EUR 95

CSH1 ORF Vector (Human) (pORF)

ORF002718 1.0 ug DNA
EUR 95

CSH1 ORF Vector (Human) (pORF)

ORF002719 1.0 ug DNA
EUR 95

CSH1 ELISA Kit (Human) (OKEH00852)

OKEH00852 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL

CSH1 ELISA Kit (Bovine) (OKEH07779)

OKEH07779 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.061ng/mL

Human Chorionic somatomammotropin hormone protein (CSH1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chorionic somatomammotropin hormone protein(CSH1) expressed in E.coli

Human Placental Lactogen (CSH1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Sheep Placental Lactogen (CSH1) ELISA Kit

abx259352-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Placental Lactogen (CSH1) ELISA Kit

abx252988-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Monkey Placental Lactogen (CSH1) ELISA Kit

abx359960-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Placental Lactogen (CSH1) ELISA Kit

abx361712-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Placental Lactogen (CSH1) ELISA Kit

abx575332-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Placental Lactogen (CSH1) ELISA Kit

abx515676-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CSH1 sgRNA CRISPR Lentivector set (Human)

K0515801 3 x 1.0 ug
EUR 339

h CSH1 (6His) inducible lentiviral particles

LVP1103 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CSH1 (6His) (human chorionic somatomammotropin hormone 1), [alternative names: CS-1; CSA; CSMT; GHB3; hCS-1; hCS-A; PL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001317.5 . It also contains a RFP-Blasticidin dual selection marker.

Human CSH1/ Chorionic somatomammotropin hormone ELISA Kit

E0573Hu 1 Kit
EUR 571

Human Chorionic somatomammotropin hormone, CSH1 ELISA KIT

ELI-03932h 96 Tests
EUR 824

Bovine chorionic somatomammotropin hormone (CSH1) ELISA kit

CSB-EL006053BO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine chorionic somatomammotropin hormone (CSH1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine chorionic somatomammotropin hormone (CSH1) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine chorionic somatomammotropin hormone (CSH1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Recombinant Human Placental Lactogen/CSH1 (C-6His)

C457-10ug 10ug
EUR 168
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Placental Lactogen/CSH1 (C-6His)

C457-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Placental Lactogen/CSH1 (C-6His)

C457-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Placental Lactogen/CSH1 (C-6His)

C457-50ug 50ug
EUR 405
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

CSH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0515802 1.0 ug DNA
EUR 154