Order Now: brent@sdlifesciences.com
COX5a Polyclonal Antibody |
ABP57030-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of COX5a from Human, Mouse, Rat. This COX5a antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COX5a at AA range: 40-120 |
COX5a Polyclonal Antibody |
ES8029-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against COX5a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
COX5a Polyclonal Antibody |
ES8029-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against COX5a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
COX5A Rabbit pAb |
A6437-100ul |
Abclonal |
100 ul |
EUR 308 |
COX5A Rabbit pAb |
A6437-200ul |
Abclonal |
200 ul |
EUR 459 |
COX5A Rabbit pAb |
A6437-20ul |
Abclonal |
20 ul |
EUR 183 |
COX5A Rabbit pAb |
A6437-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal COX5A Antibody (Center) |
APG02718G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COX5A (Center). This antibody is tested and proven to work in the following applications: |
COX5A antibody |
70R-16536 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal COX5A antibody |
COX5A antibody |
70R-15171 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal COX5A antibody |
COX5A Antibody |
34224-100ul |
SAB |
100ul |
EUR 252 |
COX5A Antibody |
34224-50ul |
SAB |
50ul |
EUR 187 |
COX5A antibody |
38915-100ul |
SAB |
100ul |
EUR 252 |
COX5A Antibody |
1-CSB-PA005836GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
COX5A Antibody |
1-CSB-PA00414A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
COX5A Antibody |
1-CSB-PA070299 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
COX5A Antibody |
CSB-PA989353- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
COX5A Antibody |
CSB-PA989353-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
COX5A Antibody |
DF3561 |
Affbiotech |
200ul |
EUR 304 |
Description: COX5A Antibody detects endogenous levels of total COX5A. |
COX5A Antibody |
1-CSB-PA584549 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
COX5A Antibody |
1-CSB-PA186754 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
COX5A antibody |
70R-50706 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal COX5A antibody |
COX5A antibody |
70R-32393 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal COX5A antibody |
Polyclonal COX5A Antibody (N-term) |
APG02719G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COX5A (N-term). This antibody is tested and proven to work in the following applications: |
COX5A Polyclonal Antibody, Biotin Conjugated |
A52613 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
COX5A Polyclonal Antibody, FITC Conjugated |
A52614 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
COX5A Polyclonal Antibody, HRP Conjugated |
A52615 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Anti-COX5A Antibody |
A07895 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal COX5A Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Human COX5A Antibody |
33354-05111 |
AssayPro |
150 ug |
EUR 261 |
COX5A antibody (HRP) |
60R-1350 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal COX5A antibody (HRP) |
COX5A antibody (FITC) |
60R-1351 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal COX5A antibody (FITC) |
COX5A antibody (biotin) |
60R-1352 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal COX5A antibody (biotin) |
COX5A Conjugated Antibody |
C34224 |
SAB |
100ul |
EUR 397 |
anti- COX5A antibody |
FNab01900 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- IF: 1:10 - 1:100
- Immunogen: cytochrome c oxidase subunit Va
- Uniprot ID: P20674
- Gene ID: 9377
- Research Area: Metabolism
|
Description: Antibody raised against COX5A |
Anti-COX5A antibody |
STJ28520 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer of proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Va of the human mitochondrial respiratory chain enzyme. A pseudogene COX5AP1 has been found in chromosome 14q22. |
Anti-COX5a antibody |
STJ92441 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to COX5a. |
COX5A siRNA |
20-abx901211 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COX5A siRNA |
20-abx912599 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COX5A siRNA |
20-abx912600 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-COX5A |
YF-PA16256 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to COX5A |
COX5A Antibody, HRP conjugated |
1-CSB-PA00414B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
COX5A Antibody, FITC conjugated |
1-CSB-PA00414C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
COX5A Antibody, Biotin conjugated |
1-CSB-PA00414D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against COX5A. Recognizes COX5A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
COX5A Blocking Peptide |
DF3561-BP |
Affbiotech |
1mg |
EUR 195 |
COX5A Blocking Peptide |
20-abx063581 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COX5A cloning plasmid |
CSB-CL005836HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 453
- Sequence: atgctgggcgccgctctccgccgctgcgctgtggccgcaaccacccgggccgaccctcgaggcctcctgcactccgcccggacccccggccccgccgtggctatccagtcagttcgctgctattcccatgggtcacaggagacagatgaggagtttgatgctcgctgggtaacata
- Show more
|
Description: A cloning plasmid for the COX5A gene. |