Order Now: brent@sdlifesciences.com
CMTM8 Polyclonal Antibody |
ABP57431-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CMTM8
- Applications tips:
|
Description: A polyclonal antibody for detection of CMTM8 from Human. This CMTM8 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CMTM8 |
CMTM8 Polyclonal Antibody |
ES8424-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CMTM8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CMTM8 Polyclonal Antibody |
ES8424-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CMTM8 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CMTM8 Antibody |
36887-100ul |
SAB |
100ul |
EUR 252 |
CMTM8 Antibody |
1-CSB-PA143153 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
CMTM8 Antibody |
1-CSB-PA809032LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
CMTM8 Antibody |
1-CSB-PA554166 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CMTM8 antibody |
70R-6363 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CMTM8 antibody raised against the middle region of CMTM8 |
Polyclonal CMTM8 antibody - middle region |
APR15525G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CMTM8 - middle region. This antibody is tested and proven to work in the following applications: |
CMTM8 Polyclonal Antibody, HRP Conjugated |
A66055 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CMTM8 Polyclonal Antibody, FITC Conjugated |
A66056 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CMTM8 Polyclonal Antibody, Biotin Conjugated |
A66057 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CMTM8 Conjugated Antibody |
C36887 |
SAB |
100ul |
EUR 397 |
anti- CMTM8 antibody |
FNab01788 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: CKLF-like MARVEL transmembrane domain containing 8
- Uniprot ID: Q8IZV2
- Gene ID: 152189
- Research Area: Signal Transduction
|
Description: Antibody raised against CMTM8 |
Anti-CMTM8 antibody |
STJ97681 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CMTM8. |
CMTM8 siRNA |
20-abx912211 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CMTM8 siRNA |
20-abx912212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-CMTM8/Cklfsf8 Antibody |
A11789 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for CMTM8 Antibody (CMTM8) detection.tested for IHC, WB in Human. |
CMTM8 Antibody, HRP conjugated |
1-CSB-PA809032LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CMTM8 Antibody, FITC conjugated |
1-CSB-PA809032LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CMTM8 Antibody, Biotin conjugated |
1-CSB-PA809032LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CMTM8. Recognizes CMTM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CMTM8 Blocking Peptide |
33R-1686 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CMTM8 antibody, catalog no. 70R-6363 |
CMTM8 Blocking Peptide |
20-abx061947 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CMTM8 cloning plasmid |
CSB-CL809032HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 522
- Sequence: atggaggagccgcagcgcgcccgctcgcacacagtcaccaccaccgccagctccttcgcagagaacttctccaccagcagcagcagcttcgcctacgaccgggagttcctccgcaccctgcacggcttcctcatcgtggccgagatcgttctggggctgctggtatggacgcttat
- Show more
|
Description: A cloning plasmid for the CMTM8 gene. |
Mouse CMTM8 shRNA Plasmid |
20-abx977113 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CMTM8 shRNA Plasmid |
20-abx965733 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CMTM8 Recombinant Protein (Human) |
RP007462 |
ABM |
100 ug |
Ask for price |
CMTM8 Recombinant Protein (Rat) |
RP195551 |
ABM |
100 ug |
Ask for price |
CMTM8 Recombinant Protein (Mouse) |
RP124931 |
ABM |
100 ug |
Ask for price |
Cmtm8 ORF Vector (Rat) (pORF) |
ORF065185 |
ABM |
1.0 ug DNA |
EUR 506 |
CMTM8 ORF Vector (Human) (pORF) |
ORF002488 |
ABM |
1.0 ug DNA |
EUR 95 |
Cmtm8 ORF Vector (Mouse) (pORF) |
ORF041645 |
ABM |
1.0 ug DNA |
EUR 506 |
CMTM8 ELISA Kit (Human) (OKEI00159) |
OKEI00159 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
CMTM8 ELISA Kit (Mouse) (OKEI00409) |
OKEI00409 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Rabbit CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) ELISA Kit |
abx362984-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CMTM8 sgRNA CRISPR Lentivector set (Human) |
K0473301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cmtm8 sgRNA CRISPR Lentivector set (Rat) |
K7264301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cmtm8 sgRNA CRISPR Lentivector set (Mouse) |
K3488701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) ELISA kit |
E04C1838-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) ELISA kit |
E04C1838-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) ELISA kit |
E04C1838-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CKLF like MARVEL transmembrane domain containing protein 8(CMTM8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CKLF-Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody |
20-abx211602 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CKLF-Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody |
20-abx212964 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody |
20-abx141249 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody |
20-abx308514 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CKLF Like MARVEL Transmembrane Domain Containing 8 (CMTM8) Antibody |
abx231788-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
CMTM8 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0473302 |
ABM |
1.0 ug DNA |
EUR 154 |
CMTM8 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0473303 |
ABM |
1.0 ug DNA |
EUR 154 |
CMTM8 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0473304 |
ABM |
1.0 ug DNA |
EUR 154 |
Cmtm8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7264302 |
ABM |
1.0 ug DNA |
EUR 154 |
Cmtm8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7264303 |
ABM |
1.0 ug DNA |
EUR 154 |
Cmtm8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7264304 |
ABM |
1.0 ug DNA |
EUR 154 |
Cmtm8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3488702 |
ABM |
1.0 ug DNA |
EUR 154 |
Cmtm8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3488703 |
ABM |
1.0 ug DNA |
EUR 154 |
Cmtm8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3488704 |
ABM |
1.0 ug DNA |
EUR 154 |
CMTM8 Protein Vector (Mouse) (pPB-C-His) |
PV166578 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Mouse) (pPB-N-His) |
PV166579 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Mouse) (pPM-C-HA) |
PV166580 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Mouse) (pPM-C-His) |
PV166581 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Rat) (pPB-C-His) |
PV260738 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Rat) (pPB-N-His) |
PV260739 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Rat) (pPM-C-HA) |
PV260740 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Rat) (pPM-C-His) |
PV260741 |
ABM |
500 ng |
EUR 603 |
CMTM8 Protein Vector (Human) (pPB-C-His) |
PV009949 |
ABM |
500 ng |
EUR 329 |
CMTM8 Protein Vector (Human) (pPB-N-His) |
PV009950 |
ABM |
500 ng |
EUR 329 |
CMTM8 Protein Vector (Human) (pPM-C-HA) |
PV009951 |
ABM |
500 ng |
EUR 329 |
CMTM8 Protein Vector (Human) (pPM-C-His) |
PV009952 |
ABM |
500 ng |
EUR 329 |
Cmtm8 3'UTR GFP Stable Cell Line |
TU154082 |
ABM |
1.0 ml |
Ask for price |
Cmtm8 3'UTR Luciferase Stable Cell Line |
TU104082 |
ABM |
1.0 ml |
Ask for price |
Cmtm8 3'UTR Luciferase Stable Cell Line |
TU202529 |
ABM |
1.0 ml |
Ask for price |
Cmtm8 3'UTR GFP Stable Cell Line |
TU252529 |
ABM |
1.0 ml |
Ask for price |