CLIC4 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

CLIC4 Polyclonal Antibody
EA278-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Polyclonal CLIC4 Antibody
APG02654G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC4 . This antibody is tested and proven to work in the following applications:

Polyclonal CLIC4 Antibody
APG02655G	Leading Biology	0.05ml	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC4 . This antibody is tested and proven to work in the following applications:

CLIC4 Polyclonal Antibody
ABP50997-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80 Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80

CLIC4 Polyclonal Antibody
ABP50997-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80 Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80

CLIC4 Polyclonal Antibody
ABP50997-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80 Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80

CLIC4 Polyclonal Antibody
ABP57314-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC4 Polyclonal Antibody
ABP57314-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC4 Polyclonal Antibody
ABP57314-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC4 Polyclonal Antibody
ES8307-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CLIC4 Polyclonal Antibody
ES8307-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CLIC4 Polyclonal Antibody
ES1996-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CLIC4 Polyclonal Antibody
ES1996-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CLIC4 Rabbit pAb
A7088-100ul	Abclonal	100 ul	EUR 308

CLIC4 Rabbit pAb
A7088-200ul	Abclonal	200 ul	EUR 459

CLIC4 Rabbit pAb
A7088-20ul	Abclonal	20 ul	EUR 183

CLIC4 Rabbit pAb
A7088-50ul	Abclonal	50 ul	EUR 223

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit
DLR-CLIC4-Hu-48T	DL Develop	48T	EUR 517
Should the Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chloride Intracellular Channel Protein 4 (CLIC4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit
DLR-CLIC4-Hu-96T	DL Develop	96T	EUR 673
Should the Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chloride Intracellular Channel Protein 4 (CLIC4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit
RDR-CLIC4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit
RDR-CLIC4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit
RD-CLIC4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit
RD-CLIC4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Polyclonal CLIC4 Antibody (aa1-50)
APG02656G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC4 (aa1-50). This antibody is tested and proven to work in the following applications:

Polyclonal CLIC4 Antibody (N-Terminus)
APG02657G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CLIC4 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-CLIC4 Antibody
AMM04935G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CLIC4 . This antibody is tested and proven to work in the following applications:

CLIC4 antibody
70R-16453	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CLIC4 antibody

CLIC4 antibody
70R-1498	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal CLIC4 antibody raised against the N terminal of CLIC4

CLIC4 Antibody
34584-100ul	SAB	100ul	EUR 252

CLIC4 Antibody
34584-50ul	SAB	50ul	EUR 187

CLIC4 Antibody
1-CSB-PA005549ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CLIC4 Antibody
1-CSB-PA005549GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CLIC4 Antibody
1-CSB-PA001691	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

CLIC4 Antibody
CSB-PA091447-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CLIC4 Antibody
CSB-PA091447-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CLIC4 Antibody
1-CSB-PA969536	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CLIC4 Antibody
DF3936	Affbiotech	200ul	EUR 304
Description: CLIC4 Antibody detects endogenous levels of total CLIC4.

CLIC4 Antibody
1-CSB-PA240685	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

CLIC4 antibody
70R-35946	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal CLIC4 antibody

CLIC4 antibody
70R-51720	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal CLIC4 antibody

CLIC4 Antibody
ABD3936	Lifescience Market	100 ug	EUR 438

CLIC4 Conjugated Antibody
C34584	SAB	100ul	EUR 397

anti- CLIC4 antibody
FNab01761	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: chloride intracellular channel 4 Uniprot ID: Q9Y696 Gene ID: 25932 Research Area: Signal Transduction
Description: Antibody raised against CLIC4

Anti-CLIC4 antibody
PAab01761	Lifescience Market	100 ug	EUR 355

Anti-CLIC4 antibody
STJ92330	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to CLIC4.

Anti-CLIC4 antibody
STJ29168	St John's Laboratory	100 µl	EUR 277
Description: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells).

Anti-CLIC4 antibody
STJ71151	St John's Laboratory	100 µg	EUR 359

Anti-CLIC4 antibody
STJ97561	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to CLIC4 (A217).

Clic4/ Rat Clic4 ELISA Kit
ELI-10369r	Lifescience Market	96 Tests	EUR 886

CLIC4 siRNA
20-abx901110	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLIC4 siRNA
20-abx912072	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLIC4 siRNA
20-abx912073	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CLIC4 Blocking Peptide
33R-5440	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLIon Channel4 antibody, catalog no. 70R-1498

CLIC4 cloning plasmid
CSB-CL897583HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 762 Sequence: atggcgttgtcgatgccgctgaatgggctgaaggaggaggacaaagagcccctcatcgagctcttcgtcaaggctggcagtgatggtgaaagcataggaaactgccccttttcccagaggctcttcatgattctttggctcaaaggagttgtatttagtgtgacgactgttgacct Show more
Description: A cloning plasmid for the CLIC4 gene.

CLIC4 Blocking Peptide
DF3936-BP	Affbiotech	1mg	EUR 195

CLIC4 Blocking Peptide
20-abx162263	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

pCMV-SPORT6-CLIC4
PVT13627	Lifescience Market	2 ug	EUR 391

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human)
4-PAF304Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4)

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse)
4-PAF304Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4)

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat)
4-PAF304Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4)

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), APC
4-PAF304Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), Biotinylated
4-PAF304Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), Cy3
4-PAF304Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), FITC
4-PAF304Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), HRP
4-PAF304Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), PE
4-PAF304Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with PE.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), APC
4-PAF304Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), Biotinylated
4-PAF304Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), Cy3
4-PAF304Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), FITC
4-PAF304Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), HRP
4-PAF304Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), PE
4-PAF304Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with PE.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), APC
4-PAF304Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), Biotinylated
4-PAF304Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), Cy3
4-PAF304Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), FITC
4-PAF304Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), HRP
4-PAF304Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), PE
4-PAF304Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with PE.

CLIC4 protein (His tag)
80R-1719	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human CLIC4 protein

CLIC4 ELISA KIT|Human
EF008724	Lifescience Market	96 Tests	EUR 689

Mouse CLIC4 shRNA Plasmid
20-abx974009	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat CLIC4 shRNA Plasmid
20-abx986841	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CLIC4 shRNA Plasmid
20-abx958598	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CLIC4 Recombinant Protein (Human)
RP007336	ABM	100 ug	Ask for price

CLIC4 Recombinant Protein (Rat)
RP195362	ABM	100 ug	Ask for price

CLIC4 Recombinant Protein (Mouse)
RP124697	ABM	100 ug	Ask for price

Rabbit Chloride intracellular channel protein 4(CLIC4) ELISA kit
E04C1794-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 4(CLIC4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 4(CLIC4) ELISA kit
E04C1794-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 4(CLIC4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 4(CLIC4) ELISA kit
E04C1794-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 4(CLIC4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), APC-Cy7
4-PAF304Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF304Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), APC-Cy7
4-PAF304Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLIC4 (Tyr104~Lys253) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx005358	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx214342	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx104148	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx104149	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx104150	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx111600	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx134023	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx134024	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx171706	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx014356	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
abx033480-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
abx033480-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx242334	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx328915	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
abx331625-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
20-abx322248	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
abx431893-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody
abx231761-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Clic4 ORF Vector (Rat) (pORF)
ORF065122	ABM	1.0 ug DNA	EUR 506

CLIC4 ORF Vector (Human) (pORF)
ORF002446	ABM	1.0 ug DNA	EUR 95

Clic4 ORF Vector (Mouse) (pORF)
ORF041567	ABM	1.0 ug DNA	EUR 506

CLIC4 ELISA Kit (Human) (OKCD01213)
OKCD01213	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Can insert into membranes and form poorly selective ion channels that may also transport chloride ions. Channel activity depends on the pH. Membrane insertion seems to be redox-regulated and may occur only under oxydizing conditions. Promotes cell-surface expression of HRH3. Has alternate cellular functions like a potential role in angiogenesis or in maintaining apical-basolateral membrane polarity during mitosis and cytokinesis. Could also promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis).6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"Differential expression of a chloride intracellular channel gene, CLIC4, in transforming growth factor-beta1-mediated conversion of fibroblasts to myofibroblasts."_x005F_x005F_x000D_Ronnov-Jessen L., Villadsen R., Edwards J.C., Petersen O.W._x005F_x005F_x000D_Am. J. Pathol. 161:471-480(2002) [PubMed] [Europe PMC] [Abstract]Cited for: INDUCTION, FUNCTION.Ref.9"CLIC4 is enriched at cell-cell junctions and colocalizes with AKAP350 at the centrosome and midbody of cultured mammalian cells."_x005F_x005F_x000D_Berryman M.A., Goldenring J.R._x005F_x005F_x000D_Cell Motil. Cytoskeleton 56:159-172(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.10"Proteomic analysis of vascular endothelial growth factor-induced endothelial cell differentiation reveals a role for chloride intracellular channel 4 (CLIC4) in tubular morphogenesis."_x005F_x005F_x000D_Bohman S., Matsumoto T., Suh K., Dimberg A., Jakobsson L., Yuspa S., Claesson-Welsh L._x005F_x005F_x000D_J. Biol. Chem. 280:42397-42404(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.13"CLIC4 interacts with histamine H3 receptor and enhances the receptor cell surface expression."_x005F_x005F_x000D_Maeda K., Haraguchi M., Kuramasu A., Sato T., Ariake K., Sakagami H., Kondo H., Yanai K., Fukunaga K., Yanagisawa T., Sukegawa J._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 369:603-608(2008) [PubMed] [Europe PMC] [Abstract]Cited for: INTERACTION WITH HRH3, FUNCTION, SUBCELLULAR LOCATION.Ref.15"Chloride intracellular channel 4 is involved in endothelial proliferation and morphogenesis in vitro."_x005F_x005F_x000D_Tung J.J., Hobert O., Berryman M., Kitajewski J._x005F_x005F_x000D_Angiogenesis 12:209-220(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.22"Crystal structure of the soluble form of the redox-regulated chloride ion channel protein CLIC4."_x005F_x005F_x000D_Littler D.R., Assaad N.N., Harrop S.J., Brown L.J., Pankhurst G.J., Luciani P., Aguilar M.-I., Mazzanti M., Berryman M.A., Breit S.N., Curmi P.M.G._x005F_x005F_x000D_FEBS J. 272:4996-5007(2005) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.8 ANGSTROMS), SUBUNIT, FUNCTION, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 30 pg/mL

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody (Biotin)
20-abx272487	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody (Biotin)
20-abx272923	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody (Biotin)
20-abx273349	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CLIC4 sgRNA CRISPR Lentivector set (Human)
K0465001	ABM	3 x 1.0 ug	EUR 339

Clic4 sgRNA CRISPR Lentivector set (Rat)
K6996401	ABM	3 x 1.0 ug	EUR 339

Clic4 sgRNA CRISPR Lentivector set (Mouse)
K4737301	ABM	3 x 1.0 ug	EUR 339

Human Chloride intracellular channel protein 4 (CLIC4)
1-CSB-EP005549HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chloride intracellular channel protein 4(CLIC4) expressed in E.coli

CLIC4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0465002	ABM	1.0 ug DNA	EUR 154

CLIC4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0465003	ABM	1.0 ug DNA	EUR 154

CLIC4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0465004	ABM	1.0 ug DNA	EUR 154

Clic4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6996402	ABM	1.0 ug DNA	EUR 154

Clic4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6996403	ABM	1.0 ug DNA	EUR 154

Clic4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6996404	ABM	1.0 ug DNA	EUR 154

Clic4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4737302	ABM	1.0 ug DNA	EUR 154

Clic4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4737303	ABM	1.0 ug DNA	EUR 154

Clic4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4737304	ABM	1.0 ug DNA	EUR 154

CLIC4 Protein Vector (Mouse) (pPB-C-His)
PV166266	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Mouse) (pPB-N-His)
PV166267	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Mouse) (pPM-C-HA)
PV166268	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Mouse) (pPM-C-His)
PV166269	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Rat) (pPB-C-His)
PV260486	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Rat) (pPB-N-His)
PV260487	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Rat) (pPM-C-HA)
PV260488	ABM	500 ng	EUR 603

CLIC4 Protein Vector (Rat) (pPM-C-His)
PV260489	ABM	500 ng	EUR 603

Recombinant Chloride Intracellular Channel Protein 4 (CLIC4)
4-RPF304Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Y696 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Chloride Intracellular Channel Protein 4 expressed in: E.coli

Recombinant Chloride Intracellular Channel Protein 4 (CLIC4)
4-RPF304Mu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QYB1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Chloride Intracellular Channel Protein 4 expressed in: E.coli

Recombinant Chloride Intracellular Channel Protein 4 (CLIC4)
4-RPF304Ra01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Z0W7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 18.4kDa Isoelectric Point: Inquire
Description: Recombinant Rat Chloride Intracellular Channel Protein 4 expressed in: E.coli

CLIC4 Protein Vector (Human) (pPB-C-His)
PV009781	ABM	500 ng	EUR 329

CLIC4 Protein Vector (Human) (pPB-N-His)
PV009782	ABM	500 ng	EUR 329