CLIC4 Rabbit Polyclonal Antibody

Order Now:

CLIC4 Polyclonal Antibody

EA278-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Polyclonal CLIC4 Antibody

APG02654G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC4 . This antibody is tested and proven to work in the following applications:

Polyclonal CLIC4 Antibody

APG02655G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC4 . This antibody is tested and proven to work in the following applications:

CLIC4 Polyclonal Antibody

ABP50997-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80

CLIC4 Polyclonal Antibody

ABP50997-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80

CLIC4 Polyclonal Antibody

ABP50997-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CLIC4 at AA range: 1-80

CLIC4 Polyclonal Antibody

ABP57314-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC4 Polyclonal Antibody

ABP57314-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC4 Polyclonal Antibody

ABP57314-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CLIC4 from Human, Mouse, Rat. This CLIC4 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CLIC4 Polyclonal Antibody

ES8307-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CLIC4 Polyclonal Antibody

ES8307-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CLIC4 Polyclonal Antibody

ES1996-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CLIC4 Polyclonal Antibody

ES1996-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CLIC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CLIC4 Rabbit pAb

A7088-100ul 100 ul
EUR 308

CLIC4 Rabbit pAb

A7088-200ul 200 ul
EUR 459

CLIC4 Rabbit pAb

A7088-20ul 20 ul
EUR 183

CLIC4 Rabbit pAb

A7088-50ul 50 ul
EUR 223

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit

DLR-CLIC4-Hu-48T 48T
EUR 517
  • Should the Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chloride Intracellular Channel Protein 4 (CLIC4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit

DLR-CLIC4-Hu-96T 96T
EUR 673
  • Should the Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chloride Intracellular Channel Protein 4 (CLIC4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit

RDR-CLIC4-Hu-48Tests 48 Tests
EUR 544

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit

RDR-CLIC4-Hu-96Tests 96 Tests
EUR 756

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit

RD-CLIC4-Hu-48Tests 48 Tests
EUR 521

Human Chloride Intracellular Channel Protein 4 (CLIC4) ELISA Kit

RD-CLIC4-Hu-96Tests 96 Tests
EUR 723

Polyclonal CLIC4 Antibody (aa1-50)

APG02656G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLIC4 (aa1-50). This antibody is tested and proven to work in the following applications:

Polyclonal CLIC4 Antibody (N-Terminus)

APG02657G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CLIC4 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-CLIC4 Antibody

AMM04935G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CLIC4 . This antibody is tested and proven to work in the following applications:

CLIC4 antibody

70R-16453 50 ul
EUR 435
Description: Rabbit polyclonal CLIC4 antibody

CLIC4 antibody

70R-1498 100 ug
EUR 377
Description: Rabbit polyclonal CLIC4 antibody raised against the N terminal of CLIC4

CLIC4 Antibody

34584-100ul 100ul
EUR 252

CLIC4 Antibody

34584-50ul 50ul
EUR 187

CLIC4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CLIC4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CLIC4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

CLIC4 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CLIC4 Antibody

CSB-PA091447-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CLIC4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CLIC4 Antibody

DF3936 200ul
EUR 304
Description: CLIC4 Antibody detects endogenous levels of total CLIC4.

CLIC4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CLIC4. Recognizes CLIC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

CLIC4 antibody

70R-35946 100 ug
EUR 327
Description: Rabbit polyclonal CLIC4 antibody

CLIC4 antibody

70R-51720 100 ul
EUR 244
Description: Purified Polyclonal CLIC4 antibody

CLIC4 Antibody

ABD3936 100 ug
EUR 438

CLIC4 Conjugated Antibody

C34584 100ul
EUR 397

anti- CLIC4 antibody

FNab01761 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: chloride intracellular channel 4
  • Uniprot ID: Q9Y696
  • Gene ID: 25932
  • Research Area: Signal Transduction
Description: Antibody raised against CLIC4

Anti-CLIC4 antibody

PAab01761 100 ug
EUR 355

Anti-CLIC4 antibody

STJ92330 200 µl
EUR 197
Description: Rabbit polyclonal to CLIC4.

Anti-CLIC4 antibody

STJ29168 100 µl
EUR 277
Description: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells).

Anti-CLIC4 antibody

STJ71151 100 µg
EUR 359

Anti-CLIC4 antibody

STJ97561 200 µl
EUR 197
Description: Rabbit polyclonal to CLIC4 (A217).

Clic4/ Rat Clic4 ELISA Kit

ELI-10369r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CLIC4 Blocking Peptide

33R-5440 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLIon Channel4 antibody, catalog no. 70R-1498

CLIC4 cloning plasmid

CSB-CL897583HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggcgttgtcgatgccgctgaatgggctgaaggaggaggacaaagagcccctcatcgagctcttcgtcaaggctggcagtgatggtgaaagcataggaaactgccccttttcccagaggctcttcatgattctttggctcaaaggagttgtatttagtgtgacgactgttgacct
  • Show more
Description: A cloning plasmid for the CLIC4 gene.

CLIC4 Blocking Peptide

DF3936-BP 1mg
EUR 195

CLIC4 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


PVT13627 2 ug
EUR 391

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4)

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4)

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4)

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with PE.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with PE.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Biotin.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with Cy3.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with FITC.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with HRP.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with PE.

CLIC4 protein (His tag)

80R-1719 100 ug
EUR 397
Description: Purified recombinant Human CLIC4 protein


EF008724 96 Tests
EUR 689

Mouse CLIC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CLIC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CLIC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLIC4 Recombinant Protein (Human)

RP007336 100 ug Ask for price

CLIC4 Recombinant Protein (Rat)

RP195362 100 ug Ask for price

CLIC4 Recombinant Protein (Mouse)

RP124697 100 ug Ask for price

Rabbit Chloride intracellular channel protein 4(CLIC4) ELISA kit

E04C1794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 4(CLIC4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 4(CLIC4) ELISA kit

E04C1794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 4(CLIC4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chloride intracellular channel protein 4(CLIC4) ELISA kit

E04C1794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chloride intracellular channel protein 4(CLIC4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 4 (CLIC4) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLIC4 (Tyr104~Lys253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Chloride Intracellular Channel Protein 4 (CLIC4). This antibody is labeled with APC-Cy7.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

abx033480-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

abx033480-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

abx331625-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

abx431893-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody

abx231761-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Clic4 ORF Vector (Rat) (pORF)

ORF065122 1.0 ug DNA
EUR 506

CLIC4 ORF Vector (Human) (pORF)

ORF002446 1.0 ug DNA
EUR 95

Clic4 ORF Vector (Mouse) (pORF)

ORF041567 1.0 ug DNA
EUR 506

CLIC4 ELISA Kit (Human) (OKCD01213)

OKCD01213 96 Wells
EUR 831
Description: Description of target: Can insert into membranes and form poorly selective ion channels that may also transport chloride ions. Channel activity depends on the pH. Membrane insertion seems to be redox-regulated and may occur only under oxydizing conditions. Promotes cell-surface expression of HRH3. Has alternate cellular functions like a potential role in angiogenesis or in maintaining apical-basolateral membrane polarity during mitosis and cytokinesis. Could also promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis).6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"Differential expression of a chloride intracellular channel gene, CLIC4, in transforming growth factor-beta1-mediated conversion of fibroblasts to myofibroblasts."_x005F_x005F_x000D_Ronnov-Jessen L., Villadsen R., Edwards J.C., Petersen O.W._x005F_x005F_x000D_Am. J. Pathol. 161:471-480(2002) [PubMed] [Europe PMC] [Abstract]Cited for: INDUCTION, FUNCTION.Ref.9"CLIC4 is enriched at cell-cell junctions and colocalizes with AKAP350 at the centrosome and midbody of cultured mammalian cells."_x005F_x005F_x000D_Berryman M.A., Goldenring J.R._x005F_x005F_x000D_Cell Motil. Cytoskeleton 56:159-172(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.10"Proteomic analysis of vascular endothelial growth factor-induced endothelial cell differentiation reveals a role for chloride intracellular channel 4 (CLIC4) in tubular morphogenesis."_x005F_x005F_x000D_Bohman S., Matsumoto T., Suh K., Dimberg A., Jakobsson L., Yuspa S., Claesson-Welsh L._x005F_x005F_x000D_J. Biol. Chem. 280:42397-42404(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.13"CLIC4 interacts with histamine H3 receptor and enhances the receptor cell surface expression."_x005F_x005F_x000D_Maeda K., Haraguchi M., Kuramasu A., Sato T., Ariake K., Sakagami H., Kondo H., Yanai K., Fukunaga K., Yanagisawa T., Sukegawa J._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 369:603-608(2008) [PubMed] [Europe PMC] [Abstract]Cited for: INTERACTION WITH HRH3, FUNCTION, SUBCELLULAR LOCATION.Ref.15"Chloride intracellular channel 4 is involved in endothelial proliferation and morphogenesis in vitro."_x005F_x005F_x000D_Tung J.J., Hobert O., Berryman M., Kitajewski J._x005F_x005F_x000D_Angiogenesis 12:209-220(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.22"Crystal structure of the soluble form of the redox-regulated chloride ion channel protein CLIC4."_x005F_x005F_x000D_Littler D.R., Assaad N.N., Harrop S.J., Brown L.J., Pankhurst G.J., Luciani P., Aguilar M.-I., Mazzanti M., Berryman M.A., Breit S.N., Curmi P.M.G._x005F_x005F_x000D_FEBS J. 272:4996-5007(2005) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.8 ANGSTROMS), SUBUNIT, FUNCTION, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 30 pg/mL

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Chloride Intracellular Channel Protein 4 (CLIC4) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CLIC4 sgRNA CRISPR Lentivector set (Human)

K0465001 3 x 1.0 ug
EUR 339

Clic4 sgRNA CRISPR Lentivector set (Rat)

K6996401 3 x 1.0 ug
EUR 339

Clic4 sgRNA CRISPR Lentivector set (Mouse)

K4737301 3 x 1.0 ug
EUR 339

Human Chloride intracellular channel protein 4 (CLIC4)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chloride intracellular channel protein 4(CLIC4) expressed in E.coli

CLIC4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0465002 1.0 ug DNA
EUR 154

CLIC4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0465003 1.0 ug DNA
EUR 154

CLIC4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0465004 1.0 ug DNA
EUR 154

Clic4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6996402 1.0 ug DNA
EUR 154

Clic4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6996403 1.0 ug DNA
EUR 154

Clic4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6996404 1.0 ug DNA
EUR 154

Clic4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4737302 1.0 ug DNA
EUR 154

Clic4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4737303 1.0 ug DNA
EUR 154

Clic4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4737304 1.0 ug DNA
EUR 154

CLIC4 Protein Vector (Mouse) (pPB-C-His)

PV166266 500 ng
EUR 603

CLIC4 Protein Vector (Mouse) (pPB-N-His)

PV166267 500 ng
EUR 603

CLIC4 Protein Vector (Mouse) (pPM-C-HA)

PV166268 500 ng
EUR 603

CLIC4 Protein Vector (Mouse) (pPM-C-His)

PV166269 500 ng
EUR 603

CLIC4 Protein Vector (Rat) (pPB-C-His)

PV260486 500 ng
EUR 603

CLIC4 Protein Vector (Rat) (pPB-N-His)

PV260487 500 ng
EUR 603

CLIC4 Protein Vector (Rat) (pPM-C-HA)

PV260488 500 ng
EUR 603

CLIC4 Protein Vector (Rat) (pPM-C-His)

PV260489 500 ng
EUR 603

Recombinant Chloride Intracellular Channel Protein 4 (CLIC4)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y696
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Chloride Intracellular Channel Protein 4 expressed in: E.coli

Recombinant Chloride Intracellular Channel Protein 4 (CLIC4)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QYB1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Chloride Intracellular Channel Protein 4 expressed in: E.coli

Recombinant Chloride Intracellular Channel Protein 4 (CLIC4)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z0W7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Chloride Intracellular Channel Protein 4 expressed in: E.coli

CLIC4 Protein Vector (Human) (pPB-C-His)

PV009781 500 ng
EUR 329

CLIC4 Protein Vector (Human) (pPB-N-His)

PV009782 500 ng
EUR 329