CEP57 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

CEP57 Polyclonal Antibody
ABP57088-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of CEP57 from Human. This CEP57 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290

CEP57 Polyclonal Antibody
ABP57088-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of CEP57 from Human. This CEP57 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CEP57 at AA range: 210-290

CEP57 Polyclonal Antibody
ES8087-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CEP57 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CEP57 Polyclonal Antibody
ES8087-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CEP57 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CEP57 Rabbit pAb
A11818-100ul 100 ul
EUR 308

CEP57 Rabbit pAb
A11818-200ul 200 ul
EUR 459

CEP57 Rabbit pAb
A11818-20ul 20 ul Ask for price

CEP57 Rabbit pAb
A11818-50ul 50 ul Ask for price

CEP57 Antibody
34567-100ul 100ul
EUR 252

CEP57 Antibody
34567-50ul 50ul
EUR 187

CEP57 Antibody
46476-100ul 100ul
EUR 252

CEP57 Antibody
1-CSB-PA080051
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

CEP57 Antibody
CSB-PA095230-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CEP57 Antibody
CSB-PA095230-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CEP57 Antibody
1-CSB-PA769805DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CEP57 Antibody
1-CSB-PA769805DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CEP57. Recognizes CEP57 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CEP57 Antibody
DF3919 200ul
EUR 304
Description: CEP57 Antibody detects endogenous levels of total CEP57.

CEP57 antibody
70R-36224 100 ug
EUR 327
Description: Rabbit polyclonal CEP57 antibody

CEP57 antibody
70R-50735 100 ul
EUR 244
Description: Purified Polyclonal CEP57 antibody

CEP57 Antibody
ABD3919 100 ug
EUR 438

Polyclonal CEP57 Antibody (N-term)
APR15407G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CEP57 (N-term). This antibody is tested and proven to work in the following applications:

Anti-CEP57 Antibody
A07898 100ul
EUR 397
Description: Rabbit Polyclonal CEP57 Antibody. Validated in WB and tested in Human.

CEP57 Conjugated Antibody
C34567 100ul
EUR 397

CEP57 Conjugated Antibody
C46476 100ul
EUR 397

Anti-CEP57 antibody
STJ113397 100 µl
EUR 277
Description: This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-CEP57 antibody
STJ92228 200 µl
EUR 197
Description: Rabbit polyclonal to CEP57.

Cep57/ Rat Cep57 ELISA Kit
ELI-10057r 96 Tests
EUR 886

CEP57 siRNA
20-abx901012
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CEP57 siRNA
20-abx911513
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CEP57 siRNA
20-abx911514
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CEP57
YF-PA16486 50 ug
EUR 363
Description: Mouse polyclonal to CEP57

anti-CEP57
YF-PA16487 100 ul
EUR 403
Description: Rabbit polyclonal to CEP57

anti-CEP57
YF-PA16488 100 ug
EUR 403
Description: Rabbit polyclonal to CEP57

CEP57 Blocking Peptide
DF3919-BP 1mg
EUR 195

CEP57 Blocking Peptide
20-abx063610
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CEP57 cloning plasmid
CSB-CL769805HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atggcggcggcgtctgtctctgcggcttctggttctcacttgtcgaacagctttgctgagccatcaaggtctaatggaagcatggttcggcattcttcatctccatatgtagtatatccttcggataagcctttccttaatagtgatctacgacgctccccaagtaagcctacact
  • Show more
Description: A cloning plasmid for the CEP57 gene.

pCMV-SPORT6-CEP57
PVT12549 2 ug
EUR 391

Anti-CEP57 (1E9)
YF-MA16976 100 ug
EUR 363
Description: Mouse monoclonal to CEP57

Centrosomal Protein 57 (CEP57) Antibody
abx330880-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Centrosomal Protein 57 (CEP57) Antibody
20-abx323909
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
20-abx008397
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
20-abx126859
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
20-abx014339
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
abx029257-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
abx029257-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
20-abx321088
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Centrosomal Protein 57 kDa (CEP57) Antibody
20-abx321955
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat CEP57 shRNA Plasmid
20-abx989878
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CEP57 shRNA Plasmid
20-abx978204
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CEP57 shRNA Plasmid
20-abx956473
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CEP57 Recombinant Protein (Human)
RP006790 100 ug Ask for price

CEP57 Recombinant Protein (Rat)
RP194588 100 ug Ask for price

CEP57 Recombinant Protein (Mouse)
RP123581 100 ug Ask for price

Rabbit Centrosomal protein of 57 kDa(CEP57) ELISA kit
E04C0954-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centrosomal protein of 57 kDa(CEP57) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centrosomal protein of 57 kDa(CEP57) ELISA kit
E04C0954-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centrosomal protein of 57 kDa(CEP57) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Centrosomal protein of 57 kDa(CEP57) ELISA kit
E04C0954-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centrosomal protein of 57 kDa(CEP57) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cep57 ORF Vector (Rat) (pORF)
ORF064864 1.0 ug DNA
EUR 506

CEP57 ORF Vector (Human) (pORF)
ORF002264 1.0 ug DNA
EUR 95

Cep57 ORF Vector (Mouse) (pORF)
ORF041195 1.0 ug DNA
EUR 506

Recombinant Centrosomal Protein 57kDa (CEP57)
4-RPF269Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86XR8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.7kDa
  • Isoelectric Point: 9
Description: Recombinant Human Centrosomal Protein 57kDa expressed in: E.coli

Recombinant Centrosomal Protein 57kDa (CEP57)
4-RPF269Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 8.5
Description: Recombinant Mouse Centrosomal Protein 57kDa expressed in: E.coli

Cep57 sgRNA CRISPR Lentivector set (Mouse)
K4880201 3 x 1.0 ug
EUR 339

CEP57 sgRNA CRISPR Lentivector set (Human)
K0433501 3 x 1.0 ug
EUR 339

Cep57 sgRNA CRISPR Lentivector set (Rat)
K6671101 3 x 1.0 ug
EUR 339

Cep57 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4880202 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4880203 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4880204 1.0 ug DNA
EUR 154

CEP57 sgRNA CRISPR Lentivector (Human) (Target 1)
K0433502 1.0 ug DNA
EUR 154

CEP57 sgRNA CRISPR Lentivector (Human) (Target 2)
K0433503 1.0 ug DNA
EUR 154

CEP57 sgRNA CRISPR Lentivector (Human) (Target 3)
K0433504 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6671102 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6671103 1.0 ug DNA
EUR 154

Cep57 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6671104 1.0 ug DNA
EUR 154

CEP57 Protein Vector (Mouse) (pPB-C-His)
PV164778 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPB-N-His)
PV164779 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPM-C-HA)
PV164780 500 ng
EUR 603

CEP57 Protein Vector (Mouse) (pPM-C-His)
PV164781 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPB-C-His)
PV259454 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPB-N-His)
PV259455 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPM-C-HA)
PV259456 500 ng
EUR 603

CEP57 Protein Vector (Rat) (pPM-C-His)
PV259457 500 ng
EUR 603

CEP57 Protein Vector (Human) (pPB-C-His)
PV009053 500 ng
EUR 329

CEP57 Protein Vector (Human) (pPB-N-His)
PV009054 500 ng
EUR 329

CEP57 Protein Vector (Human) (pPM-C-HA)
PV009055 500 ng
EUR 329

CEP57 Protein Vector (Human) (pPM-C-His)
PV009056 500 ng
EUR 329

Cep57 3'UTR GFP Stable Cell Line
TU153740 1.0 ml Ask for price

Cep57 3'UTR Luciferase Stable Cell Line
TU103740 1.0 ml Ask for price

Cep57 3'UTR Luciferase Stable Cell Line
TU202193 1.0 ml Ask for price

Cep57 3'UTR GFP Stable Cell Line
TU252193 1.0 ml Ask for price

CEP57 3'UTR GFP Stable Cell Line
TU054235 1.0 ml
EUR 1394

CEP57 3'UTR Luciferase Stable Cell Line
TU004235 1.0 ml
EUR 1394

CEP57 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV668743 1.0 ug DNA
EUR 682

CEP57 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV668747 1.0 ug DNA
EUR 682

CEP57 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV668748 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187