Order Now: brent@sdlifesciences.com
Cdc5L Polyclonal Antibody |
ABP57119-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770
- Applications tips:
|
Description: A polyclonal antibody for detection of Cdc5L from Human, Mouse, Rat. This Cdc5L antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cdc5L at AA range: 690-770 |
Cdc5L Polyclonal Antibody |
ES8118-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Cdc5L from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
Cdc5L Polyclonal Antibody |
ES8118-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Cdc5L from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
CDC5L Rabbit pAb |
A5560-100ul |
Abclonal |
100 ul |
EUR 308 |
CDC5L Rabbit pAb |
A5560-200ul |
Abclonal |
200 ul |
EUR 459 |
CDC5L Rabbit pAb |
A5560-20ul |
Abclonal |
20 ul |
EUR 183 |
CDC5L Rabbit pAb |
A5560-50ul |
Abclonal |
50 ul |
EUR 223 |
CDC5L antibody |
70R-16309 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CDC5L antibody |
CDC5L Antibody |
32911-100ul |
SAB |
100ul |
EUR 252 |
CDC5L antibody |
10R-1324 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal CDC5L antibody |
CDC5L Antibody |
49288-100ul |
SAB |
100ul |
EUR 333 |
CDC5L Antibody |
49288-50ul |
SAB |
50ul |
EUR 239 |
CDC5L Antibody |
1-CSB-PA005021GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CDC5L Antibody |
1-CSB-PA080082 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000 |
CDC5L Antibody |
1-CSB-PA858712ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
CDC5L Antibody |
1-CSB-PA858712ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CDC5L Antibody |
DF7400 |
Affbiotech |
200ul |
EUR 304 |
Description: CDC5L Antibody detects endogenous levels of total CDC5L. |
CDC5L Antibody |
1-CSB-PA478063 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
CDC5L Antibody |
1-CSB-PA218975 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CDC5L. Recognizes CDC5L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CDC5L antibody |
70R-4924 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CDC5L antibody |
CDC5L Antibody |
AF7563 |
Affbiotech |
200ul |
EUR 376 |
Description: CDC5L Antibody detects endogenous levels of CDC5L. |
CDC5L (Phospho-Tyr232) Polyclonal Conjugated Antibody |
C12928 |
SAB |
100ul |
EUR 397 |
CDC5L Conjugated Antibody |
C49288 |
SAB |
100ul |
EUR 397 |
CDC5L Conjugated Antibody |
C32911 |
SAB |
100ul |
EUR 397 |
anti- CDC5L antibody |
FNab01535 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:10 - 1:100
- Immunogen: CDC5 cell division cycle 5-like (S. pombe)
- Uniprot ID: Q99459
- Gene ID: 988
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against CDC5L |
Anti-CDC5L Antibody |
PA2123 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-CDC5L antibody |
STJ27506 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. |
Anti-Cdc5L antibody |
STJ92180 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Cdc5L. |
CDC5L siRNA |
20-abx900944 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDC5L siRNA |
20-abx911166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDC5L siRNA |
20-abx911167 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CDC5L |
YF-PA23406 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to CDC5L |
CDC5L (Phospho-Tyr232) Antibody |
12928-100ul |
SAB |
100ul |
EUR 252 |
CDC5L (Phospho-Tyr232) Antibody |
12928-50ul |
SAB |
50ul |
EUR 187 |
Phospho-CDC5L(Tyr232) Antibody |
AF7063 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-CDC5L(Tyr232) Antibody detects endogenous levels of CDC5L only when phosphorylated at Tyr232. |
CDC5L Blocking Peptide |
33R-5034 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDC5L antibody, catalog no. 70R-4924 |
CDC5L Blocking Peptide |
DF7400-BP |
Affbiotech |
1mg |
EUR 195 |
CDC5L Blocking Peptide |
AF7563-BP |
Affbiotech |
1mg |
EUR 195 |
CDC5L cloning plasmid |
CSB-CL858712HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2409
- Sequence: atgcctcgaattatgatcaaggggggcgtatggaggaataccgaggatgaaattctgaaagcagcggtaatgaaatatgggaaaaatcagtggtctaggattgcctcattgctgcatagaaaatcagcaaagcagtgcaaagccagatggtatgaatggctggatccaagcatta
- Show more
|
Description: A cloning plasmid for the CDC5L gene. |
Anti-CDC5L (3C12) |
YF-MA12357 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CDC5L |
Mouse CDC5L shRNA Plasmid |
20-abx977464 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat CDC5L shRNA Plasmid |
20-abx987028 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CDC5L shRNA Plasmid |
20-abx950703 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CDC5L Recombinant Protein (Human) |
RP006532 |
ABM |
100 ug |
Ask for price |
CDC5L Recombinant Protein (Rat) |
RP194162 |
ABM |
100 ug |
Ask for price |
CDC5L Recombinant Protein (Mouse) |
RP122894 |
ABM |
100 ug |
Ask for price |
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx004259 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx214833 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx111507 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx241486 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx320245 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx326676 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
20-abx322322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cell Division Cycle 5 Like (CDC5L) Antibody |
abx231535-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Phospho-CDC5L(Tyr232) Blocking Peptide |
AF7063-BP |
Affbiotech |
1mg |
EUR 195 |
Cdc5l ORF Vector (Rat) (pORF) |
ORF064722 |
ABM |
1.0 ug DNA |
EUR 506 |
CDC5L ORF Vector (Human) (pORF) |
ORF002178 |
ABM |
1.0 ug DNA |
EUR 95 |
Cdc5l ORF Vector (Mouse) (pORF) |
ORF040966 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit |
E04C1523-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit |
E04C1523-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cell division cycle 5 like protein(CDC5L) ELISA kit |
E04C1523-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cell division cycle 5 like protein(CDC5L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CDC5L sgRNA CRISPR Lentivector set (Human) |
K0409401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cdc5l sgRNA CRISPR Lentivector set (Rat) |
K6998501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cdc5l sgRNA CRISPR Lentivector set (Mouse) |
K4474901 |
ABM |
3 x 1.0 ug |
EUR 339 |
CDC5L sgRNA CRISPR Lentivector (Human) (Target 1) |
K0409402 |
ABM |
1.0 ug DNA |
EUR 154 |
CDC5L sgRNA CRISPR Lentivector (Human) (Target 2) |
K0409403 |
ABM |
1.0 ug DNA |
EUR 154 |
CDC5L sgRNA CRISPR Lentivector (Human) (Target 3) |
K0409404 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6998502 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6998503 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdc5l sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6998504 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4474902 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4474903 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdc5l sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4474904 |
ABM |
1.0 ug DNA |
EUR 154 |
CDC5L Protein Vector (Mouse) (pPB-C-His) |
PV163862 |
ABM |
500 ng |
EUR 1065 |
CDC5L Protein Vector (Mouse) (pPB-N-His) |
PV163863 |
ABM |
500 ng |
EUR 1065 |
CDC5L Protein Vector (Mouse) (pPM-C-HA) |
PV163864 |
ABM |
500 ng |
EUR 1065 |
CDC5L Protein Vector (Mouse) (pPM-C-His) |
PV163865 |
ABM |
500 ng |
EUR 1065 |
CDC5L Protein Vector (Rat) (pPB-C-His) |
PV258886 |
ABM |
500 ng |
EUR 1166 |
CDC5L Protein Vector (Rat) (pPB-N-His) |
PV258887 |
ABM |
500 ng |
EUR 1166 |
CDC5L Protein Vector (Rat) (pPM-C-HA) |
PV258888 |
ABM |
500 ng |
EUR 1166 |
CDC5L Protein Vector (Rat) (pPM-C-His) |
PV258889 |
ABM |
500 ng |
EUR 1166 |
CDC5L Protein Vector (Human) (pPB-C-His) |
PV008709 |
ABM |
500 ng |
EUR 329 |
CDC5L Protein Vector (Human) (pPB-N-His) |
PV008710 |
ABM |
500 ng |
EUR 329 |
CDC5L Protein Vector (Human) (pPM-C-HA) |
PV008711 |
ABM |
500 ng |
EUR 329 |
CDC5L Protein Vector (Human) (pPM-C-His) |
PV008712 |
ABM |
500 ng |
EUR 329 |
Cdc5l 3'UTR GFP Stable Cell Line |
TU153574 |
ABM |
1.0 ml |
Ask for price |
Cdc5l 3'UTR Luciferase Stable Cell Line |
TU103574 |
ABM |
1.0 ml |
Ask for price |
Cdc5l 3'UTR Luciferase Stable Cell Line |
TU202047 |
ABM |
1.0 ml |
Ask for price |
Cdc5l 3'UTR GFP Stable Cell Line |
TU252047 |
ABM |
1.0 ml |
Ask for price |
CDC5L 3'UTR GFP Stable Cell Line |
TU053960 |
ABM |
1.0 ml |
EUR 2333 |
CDC5L 3'UTR Luciferase Stable Cell Line |
TU003960 |
ABM |
1.0 ml |
EUR 2333 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |