Order Now: brent@sdlifesciences.com
CD72 Polyclonal Antibody |
ABP57395-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CD72
- Applications tips:
|
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72 |
CD72 Polyclonal Antibody |
ABP57395-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CD72
- Applications tips:
|
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72 |
CD72 Polyclonal Antibody |
ABP57395-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CD72
- Applications tips:
|
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72 |
CD72 Rabbit pAb |
A9930-100ul |
Abclonal |
100 ul |
EUR 308 |
CD72 Rabbit pAb |
A9930-200ul |
Abclonal |
200 ul |
EUR 459 |
CD72 Rabbit pAb |
A9930-20ul |
Abclonal |
20 ul |
EUR 183 |
CD72 Rabbit pAb |
A9930-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Cluster Of Differentiation 72 (CD72) ELISA Kit |
DLR-CD72-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Cluster Of Differentiation 72 (CD72) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 72 (CD72) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cluster Of Differentiation 72 (CD72) ELISA Kit |
DLR-CD72-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Cluster Of Differentiation 72 (CD72) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 72 (CD72) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Cluster Of Differentiation 72 (CD72) ELISA Kit |
RD-CD72-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Cluster Of Differentiation 72 (CD72) ELISA Kit |
RD-CD72-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Cluster Of Differentiation 72 (CD72) ELISA Kit |
RDR-CD72-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Cluster Of Differentiation 72 (CD72) ELISA Kit |
RDR-CD72-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
CD72 antibody |
70R-CR046 |
Fitzgerald |
100 ug |
EUR 300 |
Description: Affinity purified Rabbit polyclonal CD72 antibody |
CD72 antibody |
70R-CR047 |
Fitzgerald |
100 ug |
EUR 300 |
Description: Affinity purified Rabbit polyclonal CD72 antibody |
CD72 Antibody |
45176-100ul |
SAB |
100ul |
EUR 252 |
CD72 Antibody |
45176-50ul |
SAB |
50ul |
EUR 187 |
CD72 antibody |
70R-16286 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CD72 antibody |
CD72 Antibody |
DF7910 |
Affbiotech |
200ul |
EUR 304 |
Description: CD72 Antibody detects endogenous levels of total CD72. |
CD72 Antibody |
1-CSB-PA004955GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CD72 Antibody |
1-CSB-PA004955LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
CD72 Antibody |
1-CSB-PA215043 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
Rabbit B cell differentiation antigen CD72(CD72) ELISA kit |
E04B0881-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit B cell differentiation antigen CD72(CD72) ELISA kit |
E04B0881-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit B cell differentiation antigen CD72(CD72) ELISA kit |
E04B0881-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
anti- CD72 antibody |
FNab01498 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: CD72 molecule
- Uniprot ID: P21854
- Gene ID: 971
- Research Area: Immunology, Cardiovascular
|
Description: Antibody raised against CD72 |
Anti-CD72 Antibody |
A09292-1 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-CD72 antibody |
STJ97662 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CD72. |
CD72 Protein |
20-abx263522 |
Abbexa |
-
EUR 829.00
-
EUR 411.00
-
EUR 537.00
|
|
- Shipped within 5-10 working days.
|
CD72 siRNA |
20-abx911067 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD72 siRNA |
20-abx911068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD72 Antibody, HRP conjugated |
1-CSB-PA004955LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CD72 Antibody, FITC conjugated |
1-CSB-PA004955LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CD72 Antibody, Biotin conjugated |
1-CSB-PA004955LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human) |
4-PAB261Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD72 (Glu169~Asp359)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72) |
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse) |
4-PAB261Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CD72 (Leu143~Phe345)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72) |
CD72 cloning plasmid |
CSB-CL004955HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1080
- Sequence: atggctgaggccatcacctatgcagatctgaggtttgtgaaggctcccctgaagaagagcatctccagccggttaggacaggacccaggggctgatgatgatggggaaatcacctacgagaatgttcaagtgcccgcagtcctaggggtgccctcaagcttggcttcttctgtac
- Show more
|
Description: A cloning plasmid for the CD72 gene. |