Order Now: brent@sdlifesciences.com
CCKBR Polyclonal Antibody |
ABP57312-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CCKBR from Human, Mouse, Rat. This CCKBR antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CCKBR Polyclonal Antibody |
ES8305-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CCKBR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA |
CCKBR Polyclonal Antibody |
ES8305-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CCKBR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
DLR-CCKBR-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Cholecystokinin B Receptor (CCKBR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholecystokinin B Receptor (CCKBR) in samples from tissue homogenates or other biological fluids. |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
DLR-CCKBR-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Cholecystokinin B Receptor (CCKBR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholecystokinin B Receptor (CCKBR) in samples from tissue homogenates or other biological fluids. |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
RDR-CCKBR-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
RDR-CCKBR-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
RD-CCKBR-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
RD-CCKBR-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
CCKBR Rabbit pAb |
A14567-100ul |
Abclonal |
100 ul |
EUR 308 |
CCKBR Rabbit pAb |
A14567-200ul |
Abclonal |
200 ul |
EUR 459 |
CCKBR Rabbit pAb |
A14567-20ul |
Abclonal |
20 ul |
EUR 183 |
CCKBR Rabbit pAb |
A14567-50ul |
Abclonal |
50 ul |
EUR 223 |
CCKBR Rabbit pAb |
A2941-100ul |
Abclonal |
100 ul |
EUR 308 |
CCKBR Rabbit pAb |
A2941-200ul |
Abclonal |
200 ul |
EUR 459 |
CCKBR Rabbit pAb |
A2941-20ul |
Abclonal |
20 ul |
EUR 183 |
CCKBR Rabbit pAb |
A2941-50ul |
Abclonal |
50 ul |
EUR 223 |
CCKBR Antibody |
31201-100ul |
SAB |
100ul |
EUR 252 |
CCKBR Antibody |
31201-50ul |
SAB |
50ul |
EUR 187 |
CCKBR antibody |
70R-21472 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CCKBR antibody |
CCKBR antibody |
70R-31352 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CCKBR antibody |
CCKBR Antibody |
1-CSB-PA004773GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CCKBR Antibody |
1-CSB-PA001401 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
CCKBR Antibody |
1-CSB-PA094644 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
CCKBR Antibody |
1-CSB-PA12619A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
CCKBR Antibody |
1-CSB-PA924152 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:1000-2000 |
CCKBR Antibody |
DF4861 |
Affbiotech |
200ul |
EUR 304 |
Description: CCKBR Antibody detects endogenous levels of total CCKBR. |
CCKBR antibody |
70R-49487 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CCKBR antibody |
Rabbit CCKBR ELISA Kit |
ERTC0384 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal Goat Anti-CCKBR Antibody |
AMM04928G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCKBR . This antibody is tested and proven to work in the following applications: |
Polyclonal CCKBR / Cckb Antibody (Cytoplasmic Domain) |
APG02468G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCKBR / Cckb (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications: |
Anti-CCKBR Antibody |
A01677-1 |
BosterBio |
100ug/vial |
EUR 334 |
CCKBR Conjugated Antibody |
C31201 |
SAB |
100ul |
EUR 397 |
CCKBR-specific Antibody |
abx231378-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-CCKBR antibody |
STJ116778 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. |
Anti-CCKBR antibody |
STJ22926 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. |
Anti-CCKBR antibody |
STJ97559 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CCKBR (A214). |
CCKBR siRNA |
20-abx900866 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCKBR siRNA |
20-abx910748 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCKBR siRNA |
20-abx910749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCKBR Antibody, HRP conjugated |
1-CSB-PA12619B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CCKBR Antibody, FITC conjugated |
1-CSB-PA12619C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CCKBR Antibody, Biotin conjugated |
1-CSB-PA12619D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
anti- CCKBR-specific antibody |
FNab01378 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IF: 1:10-1:100
- Immunogen: cholecystokinin B receptor
- Uniprot ID: P32239
- Gene ID: 887
- Research Area: Neuroscience, Signal Transduction, Metabolism
|
Description: Antibody raised against CCKBR-specific |
Rabbit Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx363518-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CCKBR Blocking Peptide |
DF4861-BP |
Affbiotech |
1mg |
EUR 195 |
CCKBR Blocking Peptide |
20-abx062362 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCKBR cloning plasmid |
CSB-CL004773HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1344
- Sequence: atggagctgctaaagctgaaccggagcgtgcagggaaccggacccgggccgggggcttccctgtgccgcccgggggcgcctctcctcaacagcagcagtgtgggcaacctcagctgcgagccccctcgcattcgcggagccgggacacgagaattggagctggccattagaatca
- Show more
|
Description: A cloning plasmid for the CCKBR gene. |
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx007382 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx009486 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx015225 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx175841 |
Abbexa |
|
|
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx111603 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx133959 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx171718 |
Abbexa |
|
|
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx242332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx329868 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx326971 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
20-abx334345 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody |
abx431149-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody (HRP) |
20-abx335787 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody (FITC) |
20-abx335788 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cholecystokinin B Receptor (CCKBR) Antibody (Biotin) |
20-abx335789 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human CCKBR ELISA Kit |
EHC0384 |
Abclonal |
96Tests |
EUR 521 |
Goat CCKBR ELISA Kit |
EGTC0384 |
Abclonal |
96Tests |
EUR 521 |
Bovine CCKBR ELISA Kit |
EBC0384 |
Abclonal |
96Tests |
EUR 521 |
Canine CCKBR ELISA Kit |
ECC0384 |
Abclonal |
96Tests |
EUR 521 |
Anserini CCKBR ELISA Kit |
EAC0384 |
Abclonal |
96Tests |
EUR 521 |
Rat CCKBR shRNA Plasmid |
20-abx985238 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CCKBR shRNA Plasmid |
20-abx969519 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CCKBR shRNA Plasmid |
20-abx950623 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CCKBR ELISA Kit |
EMC0384 |
Abclonal |
96Tests |
EUR 521 |
Rat CCKBR ELISA Kit |
ERC0384 |
Abclonal |
96Tests |
EUR 521 |
Porcine CCKBR ELISA Kit |
EPC0384 |
Abclonal |
96Tests |
EUR 521 |
CCKBR Recombinant Protein (Human) |
RP006097 |
ABM |
100 ug |
Ask for price |
CCKBR Recombinant Protein (Rat) |
RP193619 |
ABM |
100 ug |
Ask for price |
CCKBR Recombinant Protein (Mouse) |
RP122030 |
ABM |
100 ug |
Ask for price |
Rabbit Gastrin/cholecystokinin type B receptor, CCKBR ELISA KIT |
ELI-03404Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Guinea Pig CCKBR ELISA Kit |
EGC0384 |
Abclonal |
96Tests |
EUR 521 |
Cckbr ORF Vector (Rat) (pORF) |
ORF064541 |
ABM |
1.0 ug DNA |
EUR 506 |
CCKBR ORF Vector (Human) (pORF) |
ORF002033 |
ABM |
1.0 ug DNA |
EUR 95 |
Cckbr ORF Vector (Mouse) (pORF) |
ORF040678 |
ABM |
1.0 ug DNA |
EUR 506 |
CCKBR ELISA Kit (Human) (OKCD02432) |
OKCD02432 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Receptor for gastrin and cholecystokinin. The CKK-B receptors occur throughout the central nervous system where they modulate anxiety, analgesia, arousal, and neuroleptic activity. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. Isoform 2 is constitutively activated and may regulate cancer cell proliferation via a gastrin-independent mechanism. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.052 ng/mL |
CCKBR ELISA Kit (Human) (OKCA02104) |
OKCA02104 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
Description: Description of target: Receptor for gastrin and cholecystokinin. The CKK-B receptors occur throughout the central nervous system where they modulate anxiety, analgesia, arousal, and neuroleptic activity. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. Isoform 2 is constitutively activated and may regulate cancer cell proliferation via a gastrin-independent mechanism. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL |
CCKBR ELISA Kit (Human) (OKEH07614) |
OKEH07614 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.13pg/mL |
CCKBR ELISA Kit (Mouse) (OKEI00410) |
OKEI00410 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Receptor for gastrin and cholecystokinin. The CKK-B receptors occur throughout the central nervous system where they modulate anxiety, analgesia, arousal, and neuroleptic activity. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
Anti-Human CCKBR DyLight® 488 conjugated Antibody |
A01677-Dyl488 |
BosterBio |
100ug/vial |
EUR 344 |
Anti-Human CCKBR DyLight® 550 conjugated Antibody |
A01677-Dyl550 |
BosterBio |
100ug/vial |
EUR 344 |
Human Cholecystokinin B Receptor (CCKBR) Protein |
20-abx652905 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
CCKBR sgRNA CRISPR Lentivector set (Human) |
K0388201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cckbr sgRNA CRISPR Lentivector set (Rat) |
K6789201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cckbr sgRNA CRISPR Lentivector set (Mouse) |
K4437901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
20-abx150976 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Pig Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx360735-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx352580-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx354331-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx354379-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Monkey Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx358996-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx355537-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx364089-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx570142-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Cow Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx514914-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dog Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx514915-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx514917-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Cholecystokinin B Receptor (CCKBR) ELISA Kit |
abx514918-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Cholecystokinin B Receptor (CCKBR) CLIA Kit |
20-abx492366 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
CCKBR sgRNA CRISPR Lentivector (Human) (Target 1) |
K0388202 |
ABM |
1.0 ug DNA |
EUR 154 |
CCKBR sgRNA CRISPR Lentivector (Human) (Target 2) |
K0388203 |
ABM |
1.0 ug DNA |
EUR 154 |
CCKBR sgRNA CRISPR Lentivector (Human) (Target 3) |
K0388204 |
ABM |
1.0 ug DNA |
EUR 154 |
Cckbr sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6789202 |
ABM |
1.0 ug DNA |
EUR 154 |
Cckbr sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6789203 |
ABM |
1.0 ug DNA |
EUR 154 |
Cckbr sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6789204 |
ABM |
1.0 ug DNA |
EUR 154 |
Cckbr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4437902 |
ABM |
1.0 ug DNA |
EUR 154 |
Cckbr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4437903 |
ABM |
1.0 ug DNA |
EUR 154 |
Cckbr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4437904 |
ABM |
1.0 ug DNA |
EUR 154 |
CCKBR Protein Vector (Mouse) (pPB-C-His) |
PV162710 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Mouse) (pPB-N-His) |
PV162711 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Mouse) (pPM-C-HA) |
PV162712 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Mouse) (pPM-C-His) |
PV162713 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Rat) (pPB-C-His) |
PV258162 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Rat) (pPB-N-His) |
PV258163 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Rat) (pPM-C-HA) |
PV258164 |
ABM |
500 ng |
EUR 603 |
CCKBR Protein Vector (Rat) (pPM-C-His) |
PV258165 |
ABM |
500 ng |
EUR 603 |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
SEB051Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids. |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
SEB051Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids. |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
SEB051Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids. |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
SEB051Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids. |
Human Cholecystokinin B Receptor (CCKBR) ELISA Kit |
4-SEB051Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cholecystokinin B Receptor elisa. Alternative names of the recognized antigen: CCK-B
- CCK2
- GASR
- Gastrin Receptor
- Cholecystokinin-2 receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cholecystokinin B Receptor (CCKBR) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
CCKBR Protein Vector (Human) (pPB-C-His) |
PV008129 |
ABM |
500 ng |
EUR 329 |
CCKBR Protein Vector (Human) (pPB-N-His) |
PV008130 |
ABM |
500 ng |
EUR 329 |
CCKBR Protein Vector (Human) (pPM-C-HA) |
PV008131 |
ABM |
500 ng |
EUR 329 |
CCKBR Protein Vector (Human) (pPM-C-His) |
PV008132 |
ABM |
500 ng |
EUR 329 |