CCKBR Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

CCKBR Polyclonal Antibody

ABP57312-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CCKBR from Human, Mouse, Rat. This CCKBR antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CCKBR Polyclonal Antibody

ABP57312-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CCKBR from Human, Mouse, Rat. This CCKBR antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CCKBR Polyclonal Antibody

ABP57312-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CCKBR from Human, Mouse, Rat. This CCKBR antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

DLR-CCKBR-Hu-48T 48T
EUR 498
  • Should the Human Cholecystokinin B Receptor (CCKBR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholecystokinin B Receptor (CCKBR) in samples from tissue homogenates or other biological fluids.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

DLR-CCKBR-Hu-96T 96T
EUR 647
  • Should the Human Cholecystokinin B Receptor (CCKBR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cholecystokinin B Receptor (CCKBR) in samples from tissue homogenates or other biological fluids.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

RD-CCKBR-Hu-48Tests 48 Tests
EUR 500

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

RD-CCKBR-Hu-96Tests 96 Tests
EUR 692

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

RDR-CCKBR-Hu-48Tests 48 Tests
EUR 522

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

RDR-CCKBR-Hu-96Tests 96 Tests
EUR 724

CCKBR Rabbit pAb

A2941-100ul 100 ul
EUR 308

CCKBR Rabbit pAb

A2941-200ul 200 ul
EUR 459

CCKBR Rabbit pAb

A2941-20ul 20 ul
EUR 183

CCKBR Rabbit pAb

A2941-50ul 50 ul
EUR 223

CCKBR Rabbit pAb

A14567-100ul 100 ul
EUR 308

CCKBR Rabbit pAb

A14567-200ul 200 ul
EUR 459

CCKBR Rabbit pAb

A14567-20ul 20 ul
EUR 183

CCKBR Rabbit pAb

A14567-50ul 50 ul
EUR 223

CCKBR antibody

70R-49487 100 ul
EUR 244
Description: Purified Polyclonal CCKBR antibody

CCKBR antibody

70R-21472 50 ul
EUR 435
Description: Rabbit polyclonal CCKBR antibody

CCKBR antibody

70R-31352 100 ug
EUR 327
Description: Rabbit polyclonal CCKBR antibody

CCKBR Antibody

ABD4861 100 ug
EUR 438

CCKBR Antibody

31201-100ul 100ul
EUR 252

CCKBR Antibody

31201-50ul 50ul
EUR 187

CCKBR Antibody

DF4861 200ul
EUR 304
Description: CCKBR Antibody detects endogenous levels of total CCKBR.

CCKBR Antibody

1-CSB-PA924152
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:1000-2000

CCKBR Antibody

1-CSB-PA001401
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CCKBR Antibody

1-CSB-PA004773GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCKBR Antibody

1-CSB-PA12619A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

CCKBR Antibody

1-CSB-PA094644
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Rabbit CCKBR ELISA Kit

ERTC0384 96Tests
EUR 521

Polyclonal Goat Anti-CCKBR Antibody

AMM04928G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CCKBR . This antibody is tested and proven to work in the following applications:

Polyclonal CCKBR / Cckb Antibody (Cytoplasmic Domain)

APG02468G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCKBR / Cckb (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

CCKBR Conjugated Antibody

C31201 100ul
EUR 397

CCKBR-specific Antibody

abx231378-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-CCKBR Antibody

A01677-1 100ug/vial
EUR 334

Anti-CCKBR antibody

STJ70710 100 µg
EUR 359

Anti-CCKBR antibody

STJ97559 200 µl
EUR 197
Description: Rabbit polyclonal to CCKBR (A214).

Anti-CCKBR antibody

STJ22926 100 µl
EUR 277
Description: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors.

Anti-CCKBR antibody

STJ116778 100 µl
EUR 277
Description: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors.

Cckbr/ Rat Cckbr ELISA Kit

ELI-03405r 96 Tests
EUR 886

CCKBR siRNA

20-abx900866
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCKBR siRNA

20-abx910748
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCKBR siRNA

20-abx910749
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-CCKBR

PVT12318 2 ug
EUR 391

anti- CCKBR-specific antibody

FNab01378 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: cholecystokinin B receptor
  • Uniprot ID: P32239
  • Gene ID: 887
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against CCKBR-specific

CCKBR Antibody, HRP conjugated

1-CSB-PA12619B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCKBR Antibody, FITC conjugated

1-CSB-PA12619C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCKBR Antibody, Biotin conjugated

1-CSB-PA12619D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCKBR. Recognizes CCKBR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CCKBR-specific antibody

PAab01378 100 ug
EUR 355

Rabbit Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx363518-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CCKBR cloning plasmid

CSB-CL004773HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atggagctgctaaagctgaaccggagcgtgcagggaaccggacccgggccgggggcttccctgtgccgcccgggggcgcctctcctcaacagcagcagtgtgggcaacctcagctgcgagccccctcgcattcgcggagccgggacacgagaattggagctggccattagaatca
  • Show more
Description: A cloning plasmid for the CCKBR gene.

CCKBR Blocking Peptide

20-abx062362
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CCKBR Blocking Peptide

DF4861-BP 1mg
EUR 195

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx111603
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx133959
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx009486
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx007382
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx015225
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx175841
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx326971
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx329868
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx334345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

abx431149-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx242332
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody

20-abx171718
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cholecystokinin B Receptor (CCKBR) Antibody (HRP)

20-abx335787
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody (FITC)

20-abx335788
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cholecystokinin B Receptor (CCKBR) Antibody (Biotin)

20-abx335789
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat CCKBR shRNA Plasmid

20-abx985238
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCKBR ELISA Kit

EHC0384 96Tests
EUR 521

Goat CCKBR ELISA Kit

EGTC0384 96Tests
EUR 521

Canine CCKBR ELISA Kit

ECC0384 96Tests
EUR 521

Bovine CCKBR ELISA Kit

EBC0384 96Tests
EUR 521

Anserini CCKBR ELISA Kit

EAC0384 96Tests
EUR 521

Canine CCKBR ELISA KIT

ELI-03407d 96 Tests
EUR 928

CCKBR ELISA KIT|Human

EF008467 96 Tests
EUR 689

Porcine CCKBR ELISA Kit

EPC0384 96Tests
EUR 521

Rat CCKBR ELISA Kit

ERC0384 96Tests
EUR 521

Mouse CCKBR ELISA Kit

EMC0384 96Tests
EUR 521

Human CCKBR shRNA Plasmid

20-abx950623
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCKBR shRNA Plasmid

20-abx969519
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCKBR Recombinant Protein (Human)

RP006097 100 ug Ask for price

CCKBR Recombinant Protein (Rat)

RP193619 100 ug Ask for price

CCKBR Recombinant Protein (Mouse)

RP122030 100 ug Ask for price

Rabbit Gastrin/cholecystokinin type B receptor, CCKBR ELISA KIT

ELI-03404Ra 96 Tests
EUR 928

Guinea Pig CCKBR ELISA Kit

EGC0384 96Tests
EUR 521

CCKBR ORF Vector (Human) (pORF)

ORF002033 1.0 ug DNA
EUR 95

Cckbr ORF Vector (Mouse) (pORF)

ORF040678 1.0 ug DNA
EUR 506

Cckbr ORF Vector (Rat) (pORF)

ORF064541 1.0 ug DNA
EUR 506

pLVX-AcGFP-N1-CCKBR Plasmid

PVTB00214-4a 2 ug
EUR 356

CCKBR ELISA Kit (Human) (OKCD02432)

OKCD02432 96 Wells
EUR 792
Description: Description of target: Receptor for gastrin and cholecystokinin. The CKK-B receptors occur throughout the central nervous system where they modulate anxiety, analgesia, arousal, and neuroleptic activity. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. Isoform 2 is constitutively activated and may regulate cancer cell proliferation via a gastrin-independent mechanism. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.052 ng/mL

CCKBR ELISA Kit (Human) (OKCA02104)

OKCA02104 96 Wells
EUR 917
Description: Description of target: Receptor for gastrin and cholecystokinin. The CKK-B receptors occur throughout the central nervous system where they modulate anxiety, analgesia, arousal, and neuroleptic activity. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. Isoform 2 is constitutively activated and may regulate cancer cell proliferation via a gastrin-independent mechanism. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

CCKBR ELISA Kit (Human) (OKEH07614)

OKEH07614 96 Wells
EUR 896
Description: Description of target: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.13pg/mL

CCKBR ELISA Kit (Mouse) (OKEI00410)

OKEI00410 96 Wells
EUR 767
Description: Description of target: Receptor for gastrin and cholecystokinin. The CKK-B receptors occur throughout the central nervous system where they modulate anxiety, analgesia, arousal, and neuroleptic activity. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Anti-Human CCKBR DyLight® 488 conjugated Antibody

A01677-Dyl488 100ug/vial
EUR 344

Anti-Human CCKBR DyLight® 550 conjugated Antibody

A01677-Dyl550 100ug/vial
EUR 344

Human Cholecystokinin B Receptor (CCKBR) Protein

20-abx652905
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CCKBR sgRNA CRISPR Lentivector set (Human)

K0388201 3 x 1.0 ug
EUR 339

Cckbr sgRNA CRISPR Lentivector set (Mouse)

K4437901 3 x 1.0 ug
EUR 339

Cckbr sgRNA CRISPR Lentivector set (Rat)

K6789201 3 x 1.0 ug
EUR 339

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx570142-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Pig Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx360735-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx364089-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Cow Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx514914-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx514915-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx514917-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx514918-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

CCKBR sgRNA CRISPR Lentivector (Human) (Target 1)

K0388202 1.0 ug DNA
EUR 154

CCKBR sgRNA CRISPR Lentivector (Human) (Target 2)

K0388203 1.0 ug DNA
EUR 154

CCKBR sgRNA CRISPR Lentivector (Human) (Target 3)

K0388204 1.0 ug DNA
EUR 154

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

20-abx150976
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx352580-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx354331-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx354379-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Monkey Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx358996-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Cholecystokinin B Receptor (CCKBR) ELISA Kit

abx355537-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Cholecystokinin B Receptor (CCKBR) CLIA Kit

20-abx492366
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Cckbr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4437902 1.0 ug DNA
EUR 154

Cckbr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4437903 1.0 ug DNA
EUR 154

Cckbr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4437904 1.0 ug DNA
EUR 154

Cckbr sgRNA CRISPR Lentivector (Rat) (Target 1)

K6789202 1.0 ug DNA
EUR 154

Cckbr sgRNA CRISPR Lentivector (Rat) (Target 2)

K6789203 1.0 ug DNA
EUR 154

Cckbr sgRNA CRISPR Lentivector (Rat) (Target 3)

K6789204 1.0 ug DNA
EUR 154

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

SEB051Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

SEB051Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

SEB051Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

SEB051Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cholecystokinin B Receptor (CCKBR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cholecystokinin B Receptor (CCKBR) in Tissue homogenates and other biological fluids.

Human Cholecystokinin B Receptor (CCKBR) ELISA Kit

4-SEB051Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cholecystokinin B Receptor elisa. Alternative names of the recognized antigen: CCK-B
  • CCK2
  • GASR
  • Gastrin Receptor
  • Cholecystokinin-2 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cholecystokinin B Receptor (CCKBR) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Cholecystokinin B Receptor(CCKBR)ELISA Kit

QY-E03906 96T
EUR 394

CCKBR Protein Vector (Human) (pPB-C-His)

PV008129 500 ng
EUR 329

CCKBR Protein Vector (Human) (pPB-N-His)

PV008130 500 ng
EUR 329

CCKBR Protein Vector (Human) (pPM-C-HA)

PV008131 500 ng
EUR 329

CCKBR Protein Vector (Human) (pPM-C-His)

PV008132 500 ng
EUR 329

CCKBR Protein Vector (Rat) (pPB-C-His)

PV258162 500 ng
EUR 603

CCKBR Protein Vector (Rat) (pPB-N-His)

PV258163 500 ng
EUR 603

CCKBR Protein Vector (Rat) (pPM-C-HA)

PV258164 500 ng
EUR 603

CCKBR Protein Vector (Rat) (pPM-C-His)

PV258165 500 ng
EUR 603

CCKBR Protein Vector (Mouse) (pPB-C-His)

PV162710 500 ng
EUR 603

CCKBR Protein Vector (Mouse) (pPB-N-His)

PV162711 500 ng
EUR 603

CCKBR Protein Vector (Mouse) (pPM-C-HA)

PV162712 500 ng
EUR 603

CCKBR Protein Vector (Mouse) (pPM-C-His)

PV162713 500 ng
EUR 603