Order Now: brent@sdlifesciences.com
CALHM1 Polyclonal Antibody |
EA189-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC |
Polyclonal CALHM1 Antibody |
APG02335G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALHM1 . This antibody is tested and proven to work in the following applications: |
CALHM1 Polyclonal Antibody |
ABP57219-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CALHM1 from Human, Rat. This CALHM1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CALHM1 Polyclonal Antibody |
ABP57219-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CALHM1 from Human, Rat. This CALHM1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CALHM1 Polyclonal Antibody |
ABP57219-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CALHM1 from Human, Rat. This CALHM1 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CALHM1 Polyclonal Antibody |
ES8218-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC |
CALHM1 Polyclonal Antibody |
ES8218-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CALHM1 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC |
CALHM1 Rabbit pAb |
A7858-100ul |
Abclonal |
100 ul |
EUR 308 |
CALHM1 Rabbit pAb |
A7858-200ul |
Abclonal |
200 ul |
EUR 459 |
CALHM1 Rabbit pAb |
A7858-20ul |
Abclonal |
20 ul |
EUR 183 |
CALHM1 Rabbit pAb |
A7858-50ul |
Abclonal |
50 ul |
EUR 223 |
CALHM1 Polyclonal Conjugated Antibody |
C31366 |
SAB |
100ul |
EUR 397 |
CALHM1 Antibody |
25049-100ul |
SAB |
100ul |
EUR 390 |
CALHM1 Antibody |
1-CSB-PA080190 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against CALHM1. Recognizes CALHM1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1000.IHC:1:200-500 |
CALHM1 Antibody |
1-CSB-PA808532ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CALHM1. Recognizes CALHM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CALHM1 Antibody |
1-CSB-PA808532ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CALHM1. Recognizes CALHM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Anti-CALHM1 Antibody |
A03599 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for CALHM1 Antibody (CALHM1) detection. Tested with WB, IHC in Human, Rat. |
anti- CALHM1 antibody |
FNab01200 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: calcium homeostasis modulator 1
- Uniprot ID: Q8IU99
- Gene ID: 255022
- Research Area: Neuroscience
|
Description: Antibody raised against CALHM1 |
Anti-CALHM1 antibody |
STJ110168 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear. |
Anti-CALHM1 antibody |
STJ97413 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CALHM1. |
CALHM1 siRNA |
20-abx910151 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALHM1 siRNA |
20-abx910152 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALHM1 cloning plasmid |
CSB-CL808532HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1041
- Sequence: atgatggacaagttccggatgatcttccagttcctgcagtccaaccaggagtccttcatgaatggcatctgtggcatcatggccctggccagtgcccagatgtactcggccttcgacttcaactgcccctgcctgccgggctacaatgcggcctacagcgcgggcatcctgctgg
- Show more
|
Description: A cloning plasmid for the CALHM1 gene. |
Human CALHM1 shRNA Plasmid |
20-abx966701 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CALHM1 shRNA Plasmid |
20-abx984135 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CALHM1 Recombinant Protein (Human) |
RP005467 |
ABM |
100 ug |
Ask for price |
CALHM1 Recombinant Protein (Rat) |
RP192914 |
ABM |
100 ug |
Ask for price |
CALHM1 Recombinant Protein (Mouse) |
RP120824 |
ABM |
100 ug |
Ask for price |
Rabbit Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E04C1320-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E04C1320-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium homeostasis modulator protein 1(CALHM1) ELISA kit |
E04C1320-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis modulator protein 1(CALHM1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
20-abx006561 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
20-abx134116 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
20-abx141435 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
20-abx320367 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
20-abx330208 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
20-abx322324 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Modulator Protein 1 (CALHM1) Antibody |
abx231200-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Calhm1 ORF Vector (Rat) (pORF) |
ORF064306 |
ABM |
1.0 ug DNA |
EUR 506 |
CALHM1 ORF Vector (Human) (pORF) |
ORF001823 |
ABM |
1.0 ug DNA |
EUR 95 |
Calhm1 ORF Vector (Mouse) (pORF) |
ORF040276 |
ABM |
1.0 ug DNA |
EUR 506 |
CALHM1 sgRNA CRISPR Lentivector set (Human) |
K0355101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Calhm1 sgRNA CRISPR Lentivector set (Rat) |
K6111101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Calhm1 sgRNA CRISPR Lentivector set (Mouse) |
K3025901 |
ABM |
3 x 1.0 ug |
EUR 339 |
CALHM1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0355102 |
ABM |
1.0 ug DNA |
EUR 154 |
CALHM1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0355103 |
ABM |
1.0 ug DNA |
EUR 154 |
CALHM1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0355104 |
ABM |
1.0 ug DNA |
EUR 154 |
Calhm1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6111102 |
ABM |
1.0 ug DNA |
EUR 154 |
Calhm1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6111103 |
ABM |
1.0 ug DNA |
EUR 154 |
Calhm1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6111104 |
ABM |
1.0 ug DNA |
EUR 154 |
Calhm1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3025902 |
ABM |
1.0 ug DNA |
EUR 154 |
Calhm1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3025903 |
ABM |
1.0 ug DNA |
EUR 154 |