Order Now: brent@sdlifesciences.com
CACNG3 Polyclonal Antibody |
ABP57223-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CACNG3 from Human, Mouse, Rat. This CACNG3 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CACNG3 Polyclonal Antibody |
ABP57223-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CACNG3 from Human, Mouse, Rat. This CACNG3 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CACNG3 Antibody |
46388-100ul |
SAB |
100ul |
EUR 252 |
CACNG3 antibody |
70R-16119 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CACNG3 antibody |
CACNG3 Antibody |
1-CSB-PA004417GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CACNG3 Antibody |
1-CSB-PA004417LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
CACNG3 Antibody |
1-CSB-PA080194 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500 |
Polyclonal Cacng3 antibody - C-terminal region |
AMM05667G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cacng3 - C-terminal region. This antibody is tested and proven to work in the following applications: |
CACNG3 Conjugated Antibody |
C46388 |
SAB |
100ul |
EUR 397 |
anti- CACNG3 antibody |
FNab01179 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: calcium channel, voltage-dependent, gamma subunit 3
- Uniprot ID: O60359
- Gene ID: 10368
- Research Area: Neuroscience
|
Description: Antibody raised against CACNG3 |
Anti-CACNG3 Antibody |
A13931 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for CACNG3 Antibody (CACNG3) detection. Tested with WB, IHC in Human, Mouse, Rat. |
Anti-CACNG3 antibody |
STJ97417 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CACNG3. |
CACNG3 siRNA |
20-abx900732 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CACNG3 siRNA |
20-abx910097 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CACNG3 siRNA |
20-abx910098 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CACNG3 |
YF-PA16904 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CACNG3 |
anti-CACNG3 |
YF-PA16905 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CACNG3 |
CACNG3 Antibody, HRP conjugated |
1-CSB-PA004417LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CACNG3 Antibody, FITC conjugated |
1-CSB-PA004417LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CACNG3 Antibody, Biotin conjugated |
1-CSB-PA004417LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CACNG3 cloning plasmid |
CSB-CL004417HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 948
- Sequence: atgaggatgtgtgacagaggtatccagatgttgatcaccactgtaggagcctttgccgcttttagtttaatgaccattgcagtgggcacggactactggttatattccagaggtgtgtgcaggactaaatctacaagtgataatgaaaccagcaggaagaatgaagaagtaatgac
- Show more
|
Description: A cloning plasmid for the CACNG3 gene. |
Anti-CACNG3 (3E4) |
YF-MA17273 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CACNG3 |
Mouse CACNG3 shRNA Plasmid |
20-abx974472 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat CACNG3 shRNA Plasmid |
20-abx987524 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CACNG3 shRNA Plasmid |
20-abx957025 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CACNG3 Recombinant Protein (Human) |
RP005428 |
ABM |
100 ug |
Ask for price |
CACNG3 Recombinant Protein (Rat) |
RP192839 |
ABM |
100 ug |
Ask for price |
CACNG3 Recombinant Protein (Mouse) |
RP120707 |
ABM |
100 ug |
Ask for price |
Monoclonal CACNG3 Antibody (monoclonal) (M01), Clone: 3E5 |
AMM05666G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CACNG3 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 3E5. This antibody is applicable in WB, E |
CACNG3 ORF Vector (Human) (pORF) |
ORF001810 |
ABM |
1.0 ug DNA |
EUR 95 |
Cacng3 ORF Vector (Mouse) (pORF) |
ORF040237 |
ABM |
1.0 ug DNA |
EUR 506 |
Cacng3 ORF Vector (Rat) (pORF) |
ORF064281 |
ABM |
1.0 ug DNA |
EUR 506 |
CACNG3 sgRNA CRISPR Lentivector set (Human) |
K0352601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cacng3 sgRNA CRISPR Lentivector set (Mouse) |
K3845001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cacng3 sgRNA CRISPR Lentivector set (Rat) |
K7058301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
20-abx111306 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
20-abx134705 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
abx030103-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
abx030103-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
20-abx326921 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
20-abx302337 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody |
abx231179-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
CACNG3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0352602 |
ABM |
1.0 ug DNA |
EUR 154 |
CACNG3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0352603 |
ABM |
1.0 ug DNA |
EUR 154 |
CACNG3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0352604 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3845002 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3845003 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3845004 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7058302 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7058303 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7058304 |
ABM |
1.0 ug DNA |
EUR 154 |
CACNG3 Protein Vector (Human) (pPB-C-His) |
PV007237 |
ABM |
500 ng |
EUR 329 |