CACNG3 Rabbit Polyclonal Antibody

Order Now: brent@sdlifesciences.com

CACNG3 Polyclonal Antibody

ABP57223-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG3 from Human, Mouse, Rat. This CACNG3 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CACNG3 Polyclonal Antibody

ABP57223-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG3 from Human, Mouse, Rat. This CACNG3 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CACNG3 Antibody

46388-100ul 100ul
EUR 252

CACNG3 antibody

70R-16119 50 ul
EUR 435
Description: Rabbit polyclonal CACNG3 antibody

CACNG3 Antibody

1-CSB-PA004417GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CACNG3 Antibody

1-CSB-PA004417LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CACNG3 Antibody

1-CSB-PA080194
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

Cacng3/ Rat Cacng3 ELISA Kit

ELI-50225r 96 Tests
EUR 886

Polyclonal Cacng3 antibody - C-terminal region

AMM05667G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cacng3 - C-terminal region. This antibody is tested and proven to work in the following applications:

CACNG3 Conjugated Antibody

C46388 100ul
EUR 397

anti- CACNG3 antibody

FNab01179 100µg
EUR 548.75
  • Immunogen: calcium channel, voltage-dependent, gamma subunit 3
  • Uniprot ID: O60359
  • Gene ID: 10368
  • Research Area: Neuroscience
Description: Antibody raised against CACNG3

Anti-CACNG3 Antibody

A13931 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CACNG3 Antibody (CACNG3) detection. Tested with WB, IHC in Human, Mouse, Rat.

Anti-CACNG3 antibody

PAab01179 100 ug
EUR 386

Anti-CACNG3 antibody

STJ97417 200 µl
EUR 197
Description: Rabbit polyclonal to CACNG3.

CACNG3 siRNA

20-abx900732
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CACNG3 siRNA

20-abx910097
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CACNG3 siRNA

20-abx910098
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CACNG3

YF-PA16904 50 ug
EUR 363
Description: Mouse polyclonal to CACNG3

anti-CACNG3

YF-PA16905 100 ug
EUR 403
Description: Rabbit polyclonal to CACNG3

CACNG3 Antibody, HRP conjugated

1-CSB-PA004417LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CACNG3 Antibody, FITC conjugated

1-CSB-PA004417LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CACNG3 Antibody, Biotin conjugated

1-CSB-PA004417LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACNG3. Recognizes CACNG3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CACNG3 cloning plasmid

CSB-CL004417HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 948
  • Sequence: atgaggatgtgtgacagaggtatccagatgttgatcaccactgtaggagcctttgccgcttttagtttaatgaccattgcagtgggcacggactactggttatattccagaggtgtgtgcaggactaaatctacaagtgataatgaaaccagcaggaagaatgaagaagtaatgac
  • Show more
Description: A cloning plasmid for the CACNG3 gene.

Anti-CACNG3 (3E4)

YF-MA17273 100 ug
EUR 363
Description: Mouse monoclonal to CACNG3

Mouse CACNG3 shRNA Plasmid

20-abx974472
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CACNG3 shRNA Plasmid

20-abx987524
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Cacng3 ELISA KIT

ELI-10792m 96 Tests
EUR 865

Human CACNG3 ELISA KIT

ELI-25092h 96 Tests
EUR 824

CACNG3 ELISA KIT|Human

EF008328 96 Tests
EUR 689

Bovine CACNG3 ELISA KIT

ELI-50953b 96 Tests
EUR 928

Human CACNG3 shRNA Plasmid

20-abx957025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CACNG3 Recombinant Protein (Human)

RP005428 100 ug Ask for price

CACNG3 Recombinant Protein (Rat)

RP192839 100 ug Ask for price

CACNG3 Recombinant Protein (Mouse)

RP120707 100 ug Ask for price

Monoclonal CACNG3 Antibody (monoclonal) (M01), Clone: 3E5

AMM05666G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CACNG3 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 3E5. This antibody is applicable in WB, E

CACNG3 ORF Vector (Human) (pORF)

ORF001810 1.0 ug DNA
EUR 95

Cacng3 ORF Vector (Mouse) (pORF)

ORF040237 1.0 ug DNA
EUR 506

Cacng3 ORF Vector (Rat) (pORF)

ORF064281 1.0 ug DNA
EUR 506

CACNG3 sgRNA CRISPR Lentivector set (Human)

K0352601 3 x 1.0 ug
EUR 339

Cacng3 sgRNA CRISPR Lentivector set (Mouse)

K3845001 3 x 1.0 ug
EUR 339

Cacng3 sgRNA CRISPR Lentivector set (Rat)

K7058301 3 x 1.0 ug
EUR 339

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

20-abx111306
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

20-abx134705
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

abx030103-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

abx030103-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

20-abx326921
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

20-abx302337
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-3 Subunit (CACNG3) Antibody

abx231179-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CACNG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0352602 1.0 ug DNA
EUR 154

CACNG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0352603 1.0 ug DNA
EUR 154

CACNG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0352604 1.0 ug DNA
EUR 154

Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3845002 1.0 ug DNA
EUR 154

Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3845003 1.0 ug DNA
EUR 154

Cacng3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3845004 1.0 ug DNA
EUR 154

Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7058302 1.0 ug DNA
EUR 154

Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7058303 1.0 ug DNA
EUR 154

Cacng3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7058304 1.0 ug DNA
EUR 154

CACNG3 Protein Vector (Human) (pPB-C-His)

PV007237 500 ng
EUR 329