Order Now: brent@sdlifesciences.com
CACNG2 Polyclonal Antibody |
ABP57222-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide
- Applications tips:
|
Description: A polyclonal antibody for detection of CACNG2 from Human, Mouse, Rat. This CACNG2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide |
CACNG2 Polyclonal Antibody |
ES8221-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CACNG2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
CACNG2 Polyclonal Antibody |
ES8221-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CACNG2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
CACNG2 Rabbit pAb |
A14101-100ul |
Abclonal |
100 ul |
EUR 308 |
CACNG2 Rabbit pAb |
A14101-200ul |
Abclonal |
200 ul |
EUR 459 |
CACNG2 Rabbit pAb |
A14101-20ul |
Abclonal |
20 ul |
EUR 183 |
CACNG2 Rabbit pAb |
A14101-50ul |
Abclonal |
50 ul |
EUR 223 |
CACNG2 Rabbit pAb |
A6537-100ul |
Abclonal |
100 ul |
EUR 308 |
CACNG2 Rabbit pAb |
A6537-200ul |
Abclonal |
200 ul |
EUR 459 |
CACNG2 Rabbit pAb |
A6537-20ul |
Abclonal |
20 ul |
EUR 183 |
CACNG2 Rabbit pAb |
A6537-50ul |
Abclonal |
50 ul |
EUR 223 |
CACNG2 antibody |
70R-12962 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal CACNG2 antibody |
CACNG2 antibody |
70R-15058 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Rabbit polyclonal CACNG2 antibody |
CACNG2 antibody |
38990-100ul |
SAB |
100ul |
EUR 252 |
CACNG2 Antibody |
1-CSB-PA080193 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against CACNG2. Recognizes CACNG2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500 |
CACNG2 Conjugated Antibody |
C38990 |
SAB |
100ul |
EUR 397 |
anti- CACNG2 antibody |
FNab01178 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: calcium channel, voltage-dependent, gamma subunit 2
- Uniprot ID: Q9Y698
- Gene ID: 10369
- Research Area: Neuroscience
|
Description: Antibody raised against CACNG2 |
Anti-CACNG2 antibody |
STJ28620 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for schizophrenia. |
Anti-CACNG2 antibody |
STJ116036 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for schizophrenia. |
Anti-CACNG2 antibody |
STJ97416 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CACNG2. |
CACNG2 siRNA |
20-abx910095 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CACNG2 siRNA |
20-abx910096 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-CACNG2/Stargazin Antibody |
A04541 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for CACNG2 Antibody (CACNG2) detection. Tested with WB, IHC in Human, Mouse, Rat. |
CACNG2 cloning plasmid |
CSB-CL896926HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 972
- Sequence: atggggctgtttgatcgaggtgttcaaatgcttttaaccaccgttggtgctttcgctgccttcagcctgatgaccatagctgtgggaaccgactattggctctactccagaggggtttgcaagaccaaaagtgtcagtgagaatgaaaccagcaaaaagaacgaggaagttatgac
- Show more
|
Description: A cloning plasmid for the CACNG2 gene. |
Human CACNG2 shRNA Plasmid |
20-abx957026 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CACNG2 shRNA Plasmid |
20-abx969432 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CACNG2 Recombinant Protein (Human) |
RP005425 |
ABM |
100 ug |
Ask for price |
CACNG2 Recombinant Protein (Rat) |
RP192836 |
ABM |
100 ug |
Ask for price |
CACNG2 Recombinant Protein (Mouse) |
RP120704 |
ABM |
100 ug |
Ask for price |
Cacng2 ORF Vector (Rat) (pORF) |
ORF064280 |
ABM |
1.0 ug DNA |
EUR 506 |
CACNG2 ORF Vector (Human) (pORF) |
ORF001809 |
ABM |
1.0 ug DNA |
EUR 95 |
Cacng2 ORF Vector (Mouse) (pORF) |
ORF040236 |
ABM |
1.0 ug DNA |
EUR 506 |
CACNG2 sgRNA CRISPR Lentivector set (Human) |
K0352501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cacng2 sgRNA CRISPR Lentivector set (Rat) |
K7061801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cacng2 sgRNA CRISPR Lentivector set (Mouse) |
K4389201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody |
20-abx005016 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody |
20-abx134704 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody |
20-abx326920 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody |
abx231178-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
CACNG2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0352502 |
ABM |
1.0 ug DNA |
EUR 154 |
CACNG2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0352503 |
ABM |
1.0 ug DNA |
EUR 154 |
CACNG2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0352504 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7061802 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7061803 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7061804 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4389202 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4389203 |
ABM |
1.0 ug DNA |
EUR 154 |
Cacng2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4389204 |
ABM |
1.0 ug DNA |
EUR 154 |
CACNG2 Protein Vector (Mouse) (pPB-C-His) |
PV160942 |
ABM |
500 ng |
EUR 603 |
CACNG2 Protein Vector (Mouse) (pPB-N-His) |
PV160943 |
ABM |
500 ng |
EUR 603 |
CACNG2 Protein Vector (Mouse) (pPM-C-HA) |
PV160944 |
ABM |
500 ng |
EUR 603 |