CACNG2 Rabbit Polyclonal Antibody

Order Now:

CACNG2 Polyclonal Antibody

ABP57222-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG2 from Human, Mouse, Rat. This CACNG2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CACNG2 Polyclonal Antibody

ES8221-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CACNG2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CACNG2 Polyclonal Antibody

ES8221-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CACNG2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CACNG2 Rabbit pAb

A14101-100ul 100 ul
EUR 308

CACNG2 Rabbit pAb

A14101-200ul 200 ul
EUR 459

CACNG2 Rabbit pAb

A14101-20ul 20 ul
EUR 183

CACNG2 Rabbit pAb

A14101-50ul 50 ul
EUR 223

CACNG2 Rabbit pAb

A6537-100ul 100 ul
EUR 308

CACNG2 Rabbit pAb

A6537-200ul 200 ul
EUR 459

CACNG2 Rabbit pAb

A6537-20ul 20 ul
EUR 183

CACNG2 Rabbit pAb

A6537-50ul 50 ul
EUR 223

CACNG2 antibody

70R-12962 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CACNG2 antibody

CACNG2 antibody

70R-15058 100 ul
EUR 392
Description: Rabbit polyclonal CACNG2 antibody

CACNG2 antibody

38990-100ul 100ul
EUR 252

CACNG2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CACNG2. Recognizes CACNG2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

Cacng2/ Rat Cacng2 ELISA Kit

ELI-50907r 96 Tests
EUR 886

CACNG2 Conjugated Antibody

C38990 100ul
EUR 397

anti- CACNG2 antibody

FNab01178 100µg
EUR 548.75
  • Immunogen: calcium channel, voltage-dependent, gamma subunit 2
  • Uniprot ID: Q9Y698
  • Gene ID: 10369
  • Research Area: Neuroscience
Description: Antibody raised against CACNG2

Anti-CACNG2 antibody

PAab01178 100 ug
EUR 386

Anti-CACNG2 antibody

STJ28620 100 µl
EUR 277
Description: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for schizophrenia.

Anti-CACNG2 antibody

STJ116036 100 µl
EUR 277
Description: The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for schizophrenia.

Anti-CACNG2 antibody

STJ97416 200 µl
EUR 197
Description: Rabbit polyclonal to CACNG2.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-CACNG2/Stargazin Antibody

A04541 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CACNG2 Antibody (CACNG2) detection. Tested with WB, IHC in Human, Mouse, Rat.

CACNG2 cloning plasmid

CSB-CL896926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atggggctgtttgatcgaggtgttcaaatgcttttaaccaccgttggtgctttcgctgccttcagcctgatgaccatagctgtgggaaccgactattggctctactccagaggggtttgcaagaccaaaagtgtcagtgagaatgaaaccagcaaaaagaacgaggaagttatgac
  • Show more
Description: A cloning plasmid for the CACNG2 gene.

Mouse Cacng2 ELISA KIT

ELI-25494m 96 Tests
EUR 865


EF008327 96 Tests
EUR 689

Human CACNG2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CACNG2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-50952h 96 Tests
EUR 824

CACNG2 Recombinant Protein (Human)

RP005425 100 ug Ask for price

CACNG2 Recombinant Protein (Rat)

RP192836 100 ug Ask for price

CACNG2 Recombinant Protein (Mouse)

RP120704 100 ug Ask for price

Cacng2 ORF Vector (Rat) (pORF)

ORF064280 1.0 ug DNA
EUR 506

CACNG2 ORF Vector (Human) (pORF)

ORF001809 1.0 ug DNA
EUR 95

Cacng2 ORF Vector (Mouse) (pORF)

ORF040236 1.0 ug DNA
EUR 506

pECMV-Cacng2-m-FLAG Plasmid

PVT14977 2 ug
EUR 325

CACNG2 sgRNA CRISPR Lentivector set (Human)

K0352501 3 x 1.0 ug
EUR 339

Cacng2 sgRNA CRISPR Lentivector set (Rat)

K7061801 3 x 1.0 ug
EUR 339

Cacng2 sgRNA CRISPR Lentivector set (Mouse)

K4389201 3 x 1.0 ug
EUR 339

Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Voltage-Dependent Calcium Channel Gamma-2 Subunit (CACNG2) Antibody

abx231178-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CACNG2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0352502 1.0 ug DNA
EUR 154

CACNG2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0352503 1.0 ug DNA
EUR 154

CACNG2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0352504 1.0 ug DNA
EUR 154

Cacng2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7061802 1.0 ug DNA
EUR 154

Cacng2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7061803 1.0 ug DNA
EUR 154

Cacng2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7061804 1.0 ug DNA
EUR 154

Cacng2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4389202 1.0 ug DNA
EUR 154

Cacng2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4389203 1.0 ug DNA
EUR 154

Cacng2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4389204 1.0 ug DNA
EUR 154

CACNG2 Protein Vector (Mouse) (pPB-C-His)

PV160942 500 ng
EUR 603

CACNG2 Protein Vector (Mouse) (pPB-N-His)

PV160943 500 ng
EUR 603

CACNG2 Protein Vector (Mouse) (pPM-C-HA)

PV160944 500 ng
EUR 603