BATF3 Rabbit Polyclonal Antibody

Order Now:

Batf3 Polyclonal Antibody

A50085 100 µg
EUR 570.55
Description: kits suitable for this type of research

BATF3 Polyclonal Antibody

28753-100ul 100ul
EUR 252

BATF3 Polyclonal Antibody

28753-50ul 50ul
EUR 187

BATF3 Rabbit pAb

A14906-100ul 100 ul
EUR 308

BATF3 Rabbit pAb

A14906-200ul 200 ul
EUR 459

BATF3 Rabbit pAb

A14906-20ul 20 ul
EUR 183

BATF3 Rabbit pAb

A14906-50ul 50 ul
EUR 223

BATF3 Polyclonal Conjugated Antibody

C28753 100ul
EUR 397

BATF3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Batf3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

BATF3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

Batf3 Polyclonal Antibody, HRP Conjugated

A50086 100 µg
EUR 570.55
Description: fast delivery possible

Batf3 Polyclonal Antibody, FITC Conjugated

A50087 100 µg
EUR 570.55
Description: reagents widely cited

Batf3 Polyclonal Antibody, Biotin Conjugated

A50088 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-BATF3 antibody

STJ97689 200 µl
EUR 197
Description: Rabbit polyclonal to BATF3.

Anti-BATF3 antibody

STJ117106 100 µl
EUR 277
Description: This gene encodes a member of the basic leucine zipper protein family. The encoded protein functions as a transcriptional repressor when heterodimerizing with JUN. The protein may play a role in repression of interleukin-2 and matrix metalloproteinase-1 transcription.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19736 50 ug
EUR 363
Description: Mouse polyclonal to BATF3


YF-PA26335 50 ul
EUR 334
Description: Mouse polyclonal to BATF3

Anti-BATF3/Snft Antibody

A01957 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for BATF3 Antibody (BATF3) detection.tested for IHC, WB in Human, Mouse, Rat.

BATF3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BATF3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BATF3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF3. Recognizes BATF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Batf3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Batf3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Batf3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Batf3. Recognizes Batf3 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

BATF3 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

BATF3 cloning plasmid

CSB-CL882082HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgtcgcaagggctcccggccgccggcagcgtcctgcagaggagcgtcgcggcgcccgggaaccagccgcagccgcagccgcagcagcagagccctgaggatgatgacaggaaggtccgaaggagagaaaaaaaccgagttgctgctcagagaagtcggaagaagcagacccagaa
  • Show more
Description: A cloning plasmid for the BATF3 gene.

Anti-BATF3 (3H1)

YF-MA20561 100 ug
EUR 363
Description: Mouse monoclonal to BATF3

Mouse BATF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat BATF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BATF3 protein (His tag)

80R-3698 20 ug
EUR 327
Description: Purified recombinant BATF3 protein (His tag)

Human BATF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BATF3 Recombinant Protein (Human)

RP036928 100 ug Ask for price

BATF3 Recombinant Protein (Rat)

RP191891 100 ug Ask for price

BATF3 Recombinant Protein (Mouse)

RP118760 100 ug Ask for price

Batf3 ORF Vector (Mouse) (pORF)

ORF039588 1.0 ug DNA
EUR 506

BATF3 ORF Vector (Human) (pORF)

ORF012310 1.0 ug DNA
EUR 354

Batf3 ORF Vector (Rat) (pORF)

ORF063965 1.0 ug DNA
EUR 506

BATF3 sgRNA CRISPR Lentivector set (Human)

K0171201 3 x 1.0 ug
EUR 339

Batf3 sgRNA CRISPR Lentivector set (Mouse)

K4842601 3 x 1.0 ug
EUR 339

Batf3 sgRNA CRISPR Lentivector set (Rat)

K6920701 3 x 1.0 ug
EUR 339

Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) ELISA kit

E04B0752-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) ELISA kit

E04B0752-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) ELISA kit

E04B0752-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 3(BATF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BATF3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0171202 1.0 ug DNA
EUR 154

BATF3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0171203 1.0 ug DNA
EUR 154

BATF3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0171204 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4842602 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4842603 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4842604 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6920702 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6920703 1.0 ug DNA
EUR 154

Batf3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6920704 1.0 ug DNA
EUR 154

BATF3 Protein Vector (Human) (pPB-C-His)

PV049237 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPB-N-His)

PV049238 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPM-C-HA)

PV049239 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPM-C-His)

PV049240 500 ng
EUR 481

Recombinant Human BATF3 Protein, His, E.coli-100ug

QP11129-100ug 100ug
EUR 1261

Recombinant Human BATF3 Protein, His, E.coli-10ug

QP11129-10ug 10ug
EUR 201

Recombinant Human BATF3 Protein, His, E.coli-2ug

QP11129-2ug 2ug
EUR 155

Recombinant Rat Batf3 Protein, His, E.coli-100ug

QP5704-ec-100ug 100ug
EUR 571

Recombinant Rat Batf3 Protein, His, E.coli-10ug

QP5704-ec-10ug 10ug
EUR 272

Recombinant Rat Batf3 Protein, His, E.coli-1mg

QP5704-ec-1mg 1mg
EUR 2303

Recombinant Rat Batf3 Protein, His, E.coli-200ug

QP5704-ec-200ug 200ug
EUR 898

Recombinant Rat Batf3 Protein, His, E.coli-500ug

QP5704-ec-500ug 500ug
EUR 1514

Recombinant Rat Batf3 Protein, His, E.coli-50ug

QP5704-ec-50ug 50ug
EUR 362

Recombinant Rat Batf3 Protein, His, Yeast-100ug

QP5704-ye-100ug 100ug
EUR 571

Recombinant Rat Batf3 Protein, His, Yeast-10ug

QP5704-ye-10ug 10ug
EUR 272

Recombinant Rat Batf3 Protein, His, Yeast-1mg

QP5704-ye-1mg 1mg
EUR 2303

Recombinant Rat Batf3 Protein, His, Yeast-200ug

QP5704-ye-200ug 200ug
EUR 898

Recombinant Rat Batf3 Protein, His, Yeast-500ug

QP5704-ye-500ug 500ug
EUR 1505

Recombinant Rat Batf3 Protein, His, Yeast-50ug

QP5704-ye-50ug 50ug
EUR 354

BATF3 Protein Vector (Human) (pPB-His-MBP)

PV326298 500 ng
EUR 481

BATF3 Protein Vector (Human) (pPB-His-GST)

PV326299 500 ng
EUR 481

BATF3 Protein Vector (Rat) (pPB-C-His)

PV255858 500 ng
EUR 603

BATF3 Protein Vector (Rat) (pPB-N-His)

PV255859 500 ng
EUR 603

BATF3 Protein Vector (Rat) (pPM-C-HA)

PV255860 500 ng
EUR 603