Order Now: brent@sdlifesciences.com
 ATP5J2 Polyclonal Antibody |
|
ABP57058-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human ATP5J2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATP5J2 from Human. This ATP5J2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ATP5J2 |
ATP5J2 Polyclonal Antibody |
|
ABP57058-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human ATP5J2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATP5J2 from Human. This ATP5J2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ATP5J2 |
 ATP5J2 Rabbit pAb |
|
A17055-100ul |
Abclonal |
100 ul |
EUR 308 |
ATP5J2 Rabbit pAb |
|
A17055-200ul |
Abclonal |
200 ul |
EUR 459 |
ATP5J2 Rabbit pAb |
|
A17055-20ul |
Abclonal |
20 ul |
EUR 183 |
ATP5J2 Rabbit pAb |
|
A17055-50ul |
Abclonal |
50 ul |
EUR 223 |
 ATP5J2 Antibody |
|
20-abx323086 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP5J2 Antibody |
|
45316-100ul |
SAB |
100ul |
EUR 252 |
ATP5J2 Antibody |
|
45316-50ul |
SAB |
50ul |
EUR 187 |
ATP5J2 Antibody |
|
DF8505 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ATP5J2 Antibody detects endogenous levels of total ATP5J2. |
ATP5J2 Antibody |
|
1-CSB-PA080021 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against ATP5J2. Recognizes ATP5J2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000 |
 ATP5J2 Conjugated Antibody |
|
C45316 |
SAB |
100ul |
EUR 397 |
 Anti-ATP5J2 Antibody |
|
A12564 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal ATP5J2 Antibody. Validated in IHC and tested in Human. |
 Anti-ATP5J2 antibody |
|
STJ91773 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to ATP5J2. |
 ATP5J2 siRNA |
|
20-abx900534 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP5J2 siRNA |
|
20-abx908582 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP5J2 siRNA |
|
20-abx908583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ATP5J2 Blocking Peptide |
|
DF8505-BP |
Affbiotech |
1mg |
EUR 195 |
 ATP5J2 cloning plasmid |
|
CSB-CL002370HU-10ug |
Cusabio |
10ug |
EUR 189 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 285
- Sequence: atggcgtcagttggtgagtgtccggccccagtaccagtgaaggacaagaaacttctggaggtcaaacttctggagctgccaagctggatcttgatgcgggacttcagtcctagtggcattttcggagcgtttcaaagaggttactaccggtactacaacaagtacatcaatgtgaa
- Show more
|
|
Description: A cloning plasmid for the ATP5J2 gene. |
 Mouse ATP5J2 shRNA Plasmid |
|
20-abx974994 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ATP5J2 shRNA Plasmid |
|
20-abx956352 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat ATP5J2 shRNA Plasmid |
|
20-abx991203 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ATP5J2 Recombinant Protein (Human) |
|
RP047926 |
ABM |
100 ug |
Ask for price |
) ATP5J2 Recombinant Protein (Mouse) |
|
RP118013 |
ABM |
100 ug |
Ask for price |
 ELISA kit) Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit |
|
E04A1103-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit |
|
E04A1103-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit |
|
E04A1103-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody |
|
20-abx148414 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody |
|
abx032488-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody |
|
abx032488-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 (pORF)) Atp5j2 ORF Vector (Mouse) (pORF) |
|
ORF039339 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ATP5J2 ORF Vector (Human) (pORF) |
|
ORF015976 |
ABM |
1.0 ug DNA |
EUR 405 |
) ATP5J2-PTCD1 Recombinant Protein (Human) |
|
RP047929 |
ABM |
100 ug |
Ask for price |
) ATP5J2 sgRNA CRISPR Lentivector set (Human) |
|
K0149501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Atp5j2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4625201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (pORF)) ATP5J2-PTCD1 ORF Vector (Human) (pORF) |
|
ORF015977 |
ABM |
1.0 ug DNA |
Ask for price |
 (Target 1)) ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0149502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0149503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0149504 |
ABM |
1.0 ug DNA |
EUR 154 |
) ATP5J2-PTCD1 sgRNA CRISPR Lentivector set (Human) |
|
K2749001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4625202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4625203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4625204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ATP5J2 Protein Vector (Human) (pPB-C-His) |
|
PV063901 |
ABM |
500 ng |
EUR 552 |
 (pPB-N-His)) ATP5J2 Protein Vector (Human) (pPB-N-His) |
|
PV063902 |
ABM |
500 ng |
EUR 552 |
 (pPM-C-HA)) ATP5J2 Protein Vector (Human) (pPM-C-HA) |
|
PV063903 |
ABM |
500 ng |
EUR 552 |
 (pPM-C-His)) ATP5J2 Protein Vector (Human) (pPM-C-His) |
|
PV063904 |
ABM |
500 ng |
EUR 552 |
 (pPB-His-MBP)) ATP5J2 Protein Vector (Human) (pPB-His-MBP) |
|
PV325258 |
ABM |
500 ng |
EUR 552 |
 (pPB-His-GST)) ATP5J2 Protein Vector (Human) (pPB-His-GST) |
|
PV325259 |
ABM |
500 ng |
EUR 552 |
 (pPB-C-His)) ATP5J2 Protein Vector (Mouse) (pPB-C-His) |
|
PV157354 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ATP5J2 Protein Vector (Mouse) (pPB-N-His) |
|
PV157355 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ATP5J2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV157356 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ATP5J2 Protein Vector (Mouse) (pPM-C-His) |
|
PV157357 |
ABM |
500 ng |
EUR 603 |
 Atp5j2 3'UTR Luciferase Stable Cell Line |
|
TU201089 |
ABM |
1.0 ml |
Ask for price |
 Atp5j2 3'UTR GFP Stable Cell Line |
|
TU152332 |
ABM |
1.0 ml |
Ask for price |
 ATP5J2 3'UTR Luciferase Stable Cell Line |
|
TU001421 |
ABM |
1.0 ml |
EUR 1394 |
Atp5j2 3'UTR Luciferase Stable Cell Line |
|
TU102332 |
ABM |
1.0 ml |
Ask for price |
 ATP5J2 3'UTR GFP Stable Cell Line |
|
TU051421 |
ABM |
1.0 ml |
EUR 1394 |
Atp5j2 3'UTR GFP Stable Cell Line |
|
TU251089 |
ABM |
1.0 ml |
Ask for price |
 (Target 1)) ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2749002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2749003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2749004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ATP5J2-PTCD1 Protein Vector (Human) (pPB-C-His) |
|
PV063905 |
ABM |
500 ng |
Ask for price |
 (pPB-N-His)) ATP5J2-PTCD1 Protein Vector (Human) (pPB-N-His) |
|
PV063906 |
ABM |
500 ng |
Ask for price |
 (pPM-C-HA)) ATP5J2-PTCD1 Protein Vector (Human) (pPM-C-HA) |
|
PV063907 |
ABM |
500 ng |
Ask for price |
 (pPM-C-His)) ATP5J2-PTCD1 Protein Vector (Human) (pPM-C-His) |
|
PV063908 |
ABM |
500 ng |
Ask for price |
 (pPB-His-MBP)) ATP5J2-PTCD1 Protein Vector (Human) (pPB-His-MBP) |
|
PV325262 |
ABM |
500 ng |
Ask for price |
 (pPB-His-GST)) ATP5J2-PTCD1 Protein Vector (Human) (pPB-His-GST) |
|
PV325263 |
ABM |
500 ng |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
