Order Now: brent@sdlifesciences.com
Atg9a Polyclonal Antibody |
ES8476-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Atg9a Polyclonal Antibody |
ABP57483-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthetic Peptide of Atg9a
- Applications tips:
|
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a |
Atg9a Polyclonal Antibody |
ABP57483-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthetic Peptide of Atg9a
- Applications tips:
|
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a |
Atg9a Polyclonal Antibody |
ABP57483-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthetic Peptide of Atg9a
- Applications tips:
|
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a |
ATG9A Rabbit pAb |
A5571-100ul |
Abclonal |
100 ul |
EUR 308 |
ATG9A Rabbit pAb |
A5571-200ul |
Abclonal |
200 ul |
EUR 459 |
ATG9A Rabbit pAb |
A5571-20ul |
Abclonal |
20 ul |
EUR 183 |
ATG9A Rabbit pAb |
A5571-50ul |
Abclonal |
50 ul |
EUR 223 |
ATG9A Rabbit pAb |
A7994-100ul |
Abclonal |
100 ul |
EUR 308 |
ATG9A Rabbit pAb |
A7994-200ul |
Abclonal |
200 ul |
EUR 459 |
ATG9A Rabbit pAb |
A7994-20ul |
Abclonal |
20 ul |
EUR 183 |
ATG9A Rabbit pAb |
A7994-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal ATG9A Antibody (Center) |
APG02067G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (Center). This antibody is tested and proven to work in the following applications: |
Anti-ATG9A Rabbit Monoclonal Antibody |
M03757 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal ATG9A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Atg9a antibody |
70R-9633 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Atg9a antibody |
ATG9A antibody |
70R-6415 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ATG9A antibody |
ATG9A Antibody |
36225-100ul |
SAB |
100ul |
EUR 252 |
ATG9A Antibody |
48988-100ul |
SAB |
100ul |
EUR 333 |
ATG9A Antibody |
48988-50ul |
SAB |
50ul |
EUR 239 |
ATG9A Antibody |
25202-100ul |
SAB |
100ul |
EUR 390 |
ATG9A Antibody |
DF8034 |
Affbiotech |
200ul |
EUR 304 |
Description: ATG9A Antibody detects endogenous levels of total ATG9A. |
ATG9A Antibody |
1-CSB-PA868793 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
ATG9A Antibody |
DF2695 |
Affbiotech |
200ul |
EUR 304 |
Description: ATG9A antibody detects endogenous levels of total ATG9A. |
ATG9A Antibody |
1-CSB-PA773782ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ATG9A Antibody |
1-CSB-PA554014 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
Polyclonal ATG9A Antibody (C-Terminus) |
APG02066G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal ATG9A Antibody (C-term) |
APR07027G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-term). This antibody is tested and proven to work in the following applications: |
ATG9A Conjugated Antibody |
C48988 |
SAB |
100ul |
EUR 397 |
ATG9A Conjugated Antibody |
C36225 |
SAB |
100ul |
EUR 397 |
Anti-Atg9a antibody |
STJ98589 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Atg9a. |
ATG9A siRNA |
20-abx900504 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATG9A siRNA |
20-abx908472 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATG9A siRNA |
20-abx908473 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATG9A recombinant monoclonal antibody |
A5123 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human ATG9A for WB,ELISA |
Atg9a Blocking Peptide |
33R-1246 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARGE antibody, catalog no. 70R-6856 |
ATG9A Blocking Peptide |
33R-9437 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9A antibody, catalog no. 70R-6415 |
ATG9A Blocking Peptide |
DF8034-BP |
Affbiotech |
1mg |
EUR 195 |
ATG9A Blocking Peptide |
DF2695-BP |
Affbiotech |
1mg |
EUR 195 |
ATG9A cloning plasmid |
CSB-CL773782HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1566
- Sequence: atggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacattt
- Show more
|
Description: A cloning plasmid for the ATG9A gene. |
ATG9A cloning plasmid |
CSB-CL773782HU2-10ug |
Cusabio |
10ug |
EUR 553 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1587
- Sequence: atggcgcagtttgacactgaataccagcgcctagaggcctcctatagtgattcacccccaggggaggaggacctgttggtgcacgtcgccgaggggagcaagtcaccttggcaccatattgaaaaccttgacctcttcttctctcgagtttataatctgcaccagaagaatggct
- Show more
|
Description: A cloning plasmid for the ATG9A gene. |
Autophagy Related 9A (ATG9A) Antibody |
20-abx007110 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
abx030060-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
abx030060-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
abx030061-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
abx030061-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
20-abx320321 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
abx412192-01mg |
Abbexa |
0.1 mg |
EUR 537 |
|
Autophagy Related 9A (ATG9A) Antibody |
20-abx242486 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
20-abx242504 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Autophagy Related 9A (ATG9A) Antibody |
20-abx225051 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Rabbit Autophagy related protein 9A(ATG9A) ELISA kit |
E04A1751-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Autophagy related protein 9A(ATG9A) ELISA kit |
E04A1751-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Autophagy related protein 9A(ATG9A) ELISA kit |
E04A1751-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ATG9A shRNA Plasmid |
20-abx990528 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ATG9A shRNA Plasmid |
20-abx982782 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ATG9A shRNA Plasmid |
20-abx962285 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ATG9A ORF Vector (Human) (pORF) |
ORF000742 |
ABM |
1.0 ug DNA |
EUR 95 |
ATG9A ORF Vector (Human) (pORF) |
ORF000743 |
ABM |
1.0 ug DNA |
EUR 95 |
Atg9a ORF Vector (Mouse) (pORF) |
ORF039266 |
ABM |
1.0 ug DNA |
EUR 506 |
Atg9a ORF Vector (Rat) (pORF) |
ORF063780 |
ABM |
1.0 ug DNA |
EUR 506 |
ATG9A sgRNA CRISPR Lentivector set (Human) |
K0142601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atg9a sgRNA CRISPR Lentivector set (Mouse) |
K4301701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atg9a sgRNA CRISPR Lentivector set (Rat) |
K7300301 |
ABM |
3 x 1.0 ug |
EUR 339 |
ATG9A sgRNA CRISPR Lentivector (Human) (Target 1) |
K0142602 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG9A sgRNA CRISPR Lentivector (Human) (Target 2) |
K0142603 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG9A sgRNA CRISPR Lentivector (Human) (Target 3) |
K0142604 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4301702 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4301703 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4301704 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9a sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7300302 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9a sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7300303 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9a sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7300304 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG9A Protein Vector (Human) (pPB-C-His) |
PV002965 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-N-His) |
PV002966 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPM-C-HA) |
PV002967 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPM-C-His) |
PV002968 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-C-His) |
PV002969 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-N-His) |
PV002970 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPM-C-HA) |
PV002971 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPM-C-His) |
PV002972 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-His-MBP) |
PV324806 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-His-GST) |
PV324807 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-His-MBP) |
PV324810 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Human) (pPB-His-GST) |
PV324811 |
ABM |
500 ng |
EUR 329 |
ATG9A Protein Vector (Rat) (pPB-C-His) |
PV255118 |
ABM |
500 ng |
EUR 1191 |
ATG9A Protein Vector (Rat) (pPB-N-His) |
PV255119 |
ABM |
500 ng |
EUR 1191 |
ATG9A Protein Vector (Rat) (pPM-C-HA) |
PV255120 |
ABM |
500 ng |
EUR 1191 |
ATG9A Protein Vector (Rat) (pPM-C-His) |
PV255121 |
ABM |
500 ng |
EUR 1191 |
ATG9A Protein Vector (Mouse) (pPB-C-His) |
PV157062 |
ABM |
500 ng |
EUR 1065 |
ATG9A Protein Vector (Mouse) (pPB-N-His) |
PV157063 |
ABM |
500 ng |
EUR 1065 |
ATG9A Protein Vector (Mouse) (pPM-C-HA) |
PV157064 |
ABM |
500 ng |
EUR 1065 |
ATG9A Protein Vector (Mouse) (pPM-C-His) |
PV157065 |
ABM |
500 ng |
EUR 1065 |
Atg9a 3'UTR Luciferase Stable Cell Line |
TU201033 |
ABM |
1.0 ml |
Ask for price |
Atg9a 3'UTR GFP Stable Cell Line |
TU152276 |
ABM |
1.0 ml |
Ask for price |
ATG9A 3'UTR Luciferase Stable Cell Line |
TU001344 |
ABM |
1.0 ml |
EUR 2333 |
Atg9a 3'UTR Luciferase Stable Cell Line |
TU102276 |
ABM |
1.0 ml |
Ask for price |
ATG9A 3'UTR GFP Stable Cell Line |
TU051344 |
ABM |
1.0 ml |
EUR 2333 |
Atg9a 3'UTR GFP Stable Cell Line |
TU251033 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |