Atg9a Rabbit Polyclonal Antibody

Order Now:

Atg9a Polyclonal Antibody

ES8476-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Atg9a from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Atg9a Polyclonal Antibody

ABP57483-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

Atg9a Polyclonal Antibody

ABP57483-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

Atg9a Polyclonal Antibody

ABP57483-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of Atg9a
  • Applications tips:
Description: A polyclonal antibody for detection of Atg9a from Human, Mouse, Rat. This Atg9a antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of Atg9a

ATG9A Rabbit pAb

A5571-100ul 100 ul
EUR 308

ATG9A Rabbit pAb

A5571-200ul 200 ul
EUR 459

ATG9A Rabbit pAb

A5571-20ul 20 ul
EUR 183

ATG9A Rabbit pAb

A5571-50ul 50 ul
EUR 223

ATG9A Rabbit pAb

A7994-100ul 100 ul
EUR 308

ATG9A Rabbit pAb

A7994-200ul 200 ul
EUR 459

ATG9A Rabbit pAb

A7994-20ul 20 ul
EUR 183

ATG9A Rabbit pAb

A7994-50ul 50 ul
EUR 223

Polyclonal ATG9A Antibody (Center)

APG02067G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (Center). This antibody is tested and proven to work in the following applications:

Anti-ATG9A Rabbit Monoclonal Antibody

M03757 100ug/vial
EUR 397
Description: Rabbit Monoclonal ATG9A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Atg9a antibody

70R-9633 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Atg9a antibody

ATG9A antibody

70R-6415 50 ug
EUR 467
Description: Rabbit polyclonal ATG9A antibody

ATG9A Antibody

ABD2695 100 ug
EUR 438

ATG9A Antibody

ABD8034 100 ug
EUR 438

ATG9A Antibody

ABD8346 100 ug
EUR 438

ATG9A Antibody

36225-100ul 100ul
EUR 252

ATG9A Antibody

48988-100ul 100ul
EUR 333

ATG9A Antibody

48988-50ul 50ul
EUR 239

ATG9A Antibody

25202-100ul 100ul
EUR 390

ATG9A Antibody

DF8034 200ul
EUR 304
Description: ATG9A Antibody detects endogenous levels of total ATG9A.

ATG9A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ATG9A Antibody

DF2695 200ul
EUR 304
Description: ATG9A antibody detects endogenous levels of total ATG9A.

ATG9A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ATG9A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATG9A. Recognizes ATG9A from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Polyclonal ATG9A Antibody (C-Terminus)

APG02066G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ATG9A Antibody (C-term)

APR07027G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9A (C-term). This antibody is tested and proven to work in the following applications:

ATG9A Conjugated Antibody

C48988 100ul
EUR 397

ATG9A Conjugated Antibody

C36225 100ul
EUR 397

Anti-Atg9a antibody

STJ98589 200 µl
EUR 197
Description: Rabbit polyclonal to Atg9a.

Anti-ATG9A antibody

STJ110301 100 µl
EUR 277

Anti-ATG9A antibody

STJ13100025 150 µl
EUR 427

Anti-ATG9A antibody

STJ117815 100 µl
EUR 277

Atg9a/ Rat Atg9a ELISA Kit

ELI-49603r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Anti-ATG9A monoclonal antibody, clone TD78-16

CABT-L711 100 ul
EUR 777

ATG9A recombinant monoclonal antibody

A5123 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human ATG9A for WB,ELISA

Atg9a Blocking Peptide

33R-1246 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LARGE antibody, catalog no. 70R-6856

ATG9A Blocking Peptide

33R-9437 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9A antibody, catalog no. 70R-6415

ATG9A Blocking Peptide

DF8034-BP 1mg
EUR 195

ATG9A Blocking Peptide

DF2695-BP 1mg
EUR 195

ATG9A cloning plasmid

CSB-CL773782HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1566
  • Sequence: atggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacattt
  • Show more
Description: A cloning plasmid for the ATG9A gene.

ATG9A cloning plasmid

CSB-CL773782HU2-10ug 10ug
EUR 553
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atggcgcagtttgacactgaataccagcgcctagaggcctcctatagtgattcacccccaggggaggaggacctgttggtgcacgtcgccgaggggagcaagtcaccttggcaccatattgaaaaccttgacctcttcttctctcgagtttataatctgcaccagaagaatggct
  • Show more
Description: A cloning plasmid for the ATG9A gene.

Autophagy Related 9A (ATG9A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

abx030060-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

abx030060-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

abx030061-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

abx030061-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

abx412192-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Autophagy Related 9A (ATG9A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related 9A (ATG9A) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit

E04A1751-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit

E04A1751-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9A(ATG9A) ELISA kit

E04A1751-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9A(ATG9A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATG9A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ATG9A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ATG9A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-Flag-ATG9A Plasmid

PVTB01039-2a 2 ug
EUR 356

ATG9A ORF Vector (Human) (pORF)

ORF000742 1.0 ug DNA
EUR 95

ATG9A ORF Vector (Human) (pORF)

ORF000743 1.0 ug DNA
EUR 95

Atg9a ORF Vector (Mouse) (pORF)

ORF039266 1.0 ug DNA
EUR 506

Atg9a ORF Vector (Rat) (pORF)

ORF063780 1.0 ug DNA
EUR 506

pECMV-Atg9a-m-FLAG Plasmid

PVT15103 2 ug
EUR 325

ATG9A sgRNA CRISPR Lentivector set (Human)

K0142601 3 x 1.0 ug
EUR 339

Atg9a sgRNA CRISPR Lentivector set (Mouse)

K4301701 3 x 1.0 ug
EUR 339

Atg9a sgRNA CRISPR Lentivector set (Rat)

K7300301 3 x 1.0 ug
EUR 339

ATG9A sgRNA CRISPR Lentivector (Human) (Target 1)

K0142602 1.0 ug DNA
EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 2)

K0142603 1.0 ug DNA
EUR 154

ATG9A sgRNA CRISPR Lentivector (Human) (Target 3)

K0142604 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4301702 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4301703 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4301704 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7300302 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7300303 1.0 ug DNA
EUR 154

Atg9a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7300304 1.0 ug DNA
EUR 154

ATG9A Protein Vector (Human) (pPB-C-His)

PV002965 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-N-His)

PV002966 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-HA)

PV002967 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-His)

PV002968 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-C-His)

PV002969 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-N-His)

PV002970 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-HA)

PV002971 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPM-C-His)

PV002972 500 ng
EUR 329

pGEX-4T-1-ATG9A(670-839aa) Plasmid

PVTB01039-1a 2 ug
EUR 356

ATG9A Protein Vector (Human) (pPB-His-MBP)

PV324806 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-His-GST)

PV324807 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-His-MBP)

PV324810 500 ng
EUR 329

ATG9A Protein Vector (Human) (pPB-His-GST)

PV324811 500 ng
EUR 329

ATG9A Protein Vector (Rat) (pPB-C-His)

PV255118 500 ng
EUR 1191

ATG9A Protein Vector (Rat) (pPB-N-His)

PV255119 500 ng
EUR 1191

ATG9A Protein Vector (Rat) (pPM-C-HA)

PV255120 500 ng
EUR 1191

ATG9A Protein Vector (Rat) (pPM-C-His)

PV255121 500 ng
EUR 1191

ATG9A Protein Vector (Mouse) (pPB-C-His)

PV157062 500 ng
EUR 1065

ATG9A Protein Vector (Mouse) (pPB-N-His)

PV157063 500 ng
EUR 1065

ATG9A Protein Vector (Mouse) (pPM-C-HA)

PV157064 500 ng
EUR 1065

ATG9A Protein Vector (Mouse) (pPM-C-His)

PV157065 500 ng
EUR 1065

Atg9a 3'UTR Luciferase Stable Cell Line

TU201033 1.0 ml Ask for price

Atg9a 3'UTR GFP Stable Cell Line

TU152276 1.0 ml Ask for price

ATG9A 3'UTR Luciferase Stable Cell Line

TU001344 1.0 ml
EUR 2333

Atg9a 3'UTR Luciferase Stable Cell Line

TU102276 1.0 ml Ask for price

ATG9A 3'UTR GFP Stable Cell Line

TU051344 1.0 ml
EUR 2333

Atg9a 3'UTR GFP Stable Cell Line

TU251033 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC